Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626850_s_at:

>probe:Drosophila_2:1626850_s_at:108:215; Interrogation_Position=112; Antisense; AAGATGATCTATCCCAGCTACGGCA
>probe:Drosophila_2:1626850_s_at:685:139; Interrogation_Position=137; Antisense; ACGTCGCGGGCAGTCATGATGGAAT
>probe:Drosophila_2:1626850_s_at:694:531; Interrogation_Position=172; Antisense; GGGTGTTTGCCCTACGGCAAGAACA
>probe:Drosophila_2:1626850_s_at:446:211; Interrogation_Position=190; Antisense; AAGAACACCAACGATAAGCAGCCAT
>probe:Drosophila_2:1626850_s_at:349:313; Interrogation_Position=210; Antisense; GCCATGGCTCAAGGACTATCTGCAG
>probe:Drosophila_2:1626850_s_at:191:251; Interrogation_Position=235; Antisense; CAATGGAAGTCCAGCGATCGCTTTC
>probe:Drosophila_2:1626850_s_at:674:565; Interrogation_Position=267; Antisense; GGCAATGCCGCACATCAAGAGCTAT
>probe:Drosophila_2:1626850_s_at:565:339; Interrogation_Position=287; Antisense; GCTATACGCGCTTCAATCTGGAGGA
>probe:Drosophila_2:1626850_s_at:296:453; Interrogation_Position=310; Antisense; GATCAGTCGGTGTACTGGTTCGTTT
>probe:Drosophila_2:1626850_s_at:659:697; Interrogation_Position=333; Antisense; TTTAACCTCGGCGAATCTCTCGAAG
>probe:Drosophila_2:1626850_s_at:491:411; Interrogation_Position=591; Antisense; GACGCCCTATGCTCCAGATGATAAG
>probe:Drosophila_2:1626850_s_at:663:443; Interrogation_Position=607; Antisense; GATGATAAGCCCTTCCTGATGGATT
>probe:Drosophila_2:1626850_s_at:65:111; Interrogation_Position=65; Antisense; AGAAGGATTCCACGCCTGTGGGCAA
>probe:Drosophila_2:1626850_s_at:633:447; Interrogation_Position=99; Antisense; GATGCCGCCCTTCAAGATGATCTAT

Paste this into a BLAST search page for me
AAGATGATCTATCCCAGCTACGGCAACGTCGCGGGCAGTCATGATGGAATGGGTGTTTGCCCTACGGCAAGAACAAAGAACACCAACGATAAGCAGCCATGCCATGGCTCAAGGACTATCTGCAGCAATGGAAGTCCAGCGATCGCTTTCGGCAATGCCGCACATCAAGAGCTATGCTATACGCGCTTCAATCTGGAGGAGATCAGTCGGTGTACTGGTTCGTTTTTTAACCTCGGCGAATCTCTCGAAGGACGCCCTATGCTCCAGATGATAAGGATGATAAGCCCTTCCTGATGGATTAGAAGGATTCCACGCCTGTGGGCAAGATGCCGCCCTTCAAGATGATCTAT

Full Affymetrix probeset data:

Annotations for 1626850_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime