FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626851_at:

>probe:Drosophila_2:1626851_at:363:199; Interrogation_Position=1029; Antisense; AACCCCTACGCATCTCGGAGGTGAA
>probe:Drosophila_2:1626851_at:470:223; Interrogation_Position=1115; Antisense; AAGGTCTCGGTGGAGTCGCTTACGA
>probe:Drosophila_2:1626851_at:717:481; Interrogation_Position=1151; Antisense; GTATTCGAGTTCATCGCGGATCATC
>probe:Drosophila_2:1626851_at:346:443; Interrogation_Position=1196; Antisense; GATGCCCAAAACACCTTATTCCTGG
>probe:Drosophila_2:1626851_at:601:703; Interrogation_Position=1211; Antisense; TTATTCCTGGGCCACGTCAGTCAGT
>probe:Drosophila_2:1626851_at:156:577; Interrogation_Position=1244; Antisense; GGCGCTGGAATTCCCCAATATGATG
>probe:Drosophila_2:1626851_at:417:57; Interrogation_Position=1263; Antisense; ATGATGTTTTGTCCGCATCCAATAA
>probe:Drosophila_2:1626851_at:210:665; Interrogation_Position=1285; Antisense; TAAATGCCAGTTCACGATGTCAAGT
>probe:Drosophila_2:1626851_at:265:541; Interrogation_Position=718; Antisense; GGATTACTTTAGGTTCGGCGAACTG
>probe:Drosophila_2:1626851_at:233:459; Interrogation_Position=788; Antisense; GATATCGTTTTCCTGATCATCCTGC
>probe:Drosophila_2:1626851_at:365:267; Interrogation_Position=824; Antisense; CAGGGACTGGCCATCGTCGAGGAAA
>probe:Drosophila_2:1626851_at:17:511; Interrogation_Position=908; Antisense; GTGCAGCTGCCCAAATTCAAATTCG
>probe:Drosophila_2:1626851_at:417:715; Interrogation_Position=929; Antisense; TTCGAATTTGATGTCCCTCTACAGG
>probe:Drosophila_2:1626851_at:275:357; Interrogation_Position=998; Antisense; GCAAATCTGAGCAGCCTGTACCAGG

Paste this into a BLAST search page for me
AACCCCTACGCATCTCGGAGGTGAAAAGGTCTCGGTGGAGTCGCTTACGAGTATTCGAGTTCATCGCGGATCATCGATGCCCAAAACACCTTATTCCTGGTTATTCCTGGGCCACGTCAGTCAGTGGCGCTGGAATTCCCCAATATGATGATGATGTTTTGTCCGCATCCAATAATAAATGCCAGTTCACGATGTCAAGTGGATTACTTTAGGTTCGGCGAACTGGATATCGTTTTCCTGATCATCCTGCCAGGGACTGGCCATCGTCGAGGAAAGTGCAGCTGCCCAAATTCAAATTCGTTCGAATTTGATGTCCCTCTACAGGGCAAATCTGAGCAGCCTGTACCAGG

Full Affymetrix probeset data:

Annotations for 1626851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720