Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626853_a_at:

>probe:Drosophila_2:1626853_a_at:439:315; Interrogation_Position=118; Antisense; GCCGGTTCCAAAGGATTTCGAGCTT
>probe:Drosophila_2:1626853_a_at:367:211; Interrogation_Position=158; Antisense; AAGACATCGCCTACAATCACTATTT
>probe:Drosophila_2:1626853_a_at:18:559; Interrogation_Position=204; Antisense; GGACAGACGGTATCTACCCAACGAT
>probe:Drosophila_2:1626853_a_at:155:133; Interrogation_Position=289; Antisense; ACCCAGTTCAACGAGGTGCACTTCT
>probe:Drosophila_2:1626853_a_at:26:563; Interrogation_Position=322; Antisense; GGAACGTGCTTCTATTTCAGCGAGA
>probe:Drosophila_2:1626853_a_at:105:241; Interrogation_Position=346; Antisense; AATAATGTCCCCAATGATCCACTGA
>probe:Drosophila_2:1626853_a_at:13:405; Interrogation_Position=369; Antisense; GACTATGGCACTTCTAGAGCGCGAA
>probe:Drosophila_2:1626853_a_at:60:43; Interrogation_Position=439; Antisense; ATCGTATTCGTGAGCACCCGAGATT
>probe:Drosophila_2:1626853_a_at:174:463; Interrogation_Position=460; Antisense; GATTCCAAGGGCTTCAATATCTCCG
>probe:Drosophila_2:1626853_a_at:263:243; Interrogation_Position=475; Antisense; AATATCTCCGGCTACATCGATTTGG
>probe:Drosophila_2:1626853_a_at:725:485; Interrogation_Position=512; Antisense; GTAGATACAAGACCGCTGGATCGAA
>probe:Drosophila_2:1626853_a_at:30:45; Interrogation_Position=531; Antisense; ATCGAAGTCTCATCCGTGGGCAGAT
>probe:Drosophila_2:1626853_a_at:586:517; Interrogation_Position=546; Antisense; GTGGGCAGATATTTTCGCCGGTCGC
>probe:Drosophila_2:1626853_a_at:424:587; Interrogation_Position=578; Antisense; TGGAGCCCAATCATCAGGATCTAAG

Paste this into a BLAST search page for me
GCCGGTTCCAAAGGATTTCGAGCTTAAGACATCGCCTACAATCACTATTTGGACAGACGGTATCTACCCAACGATACCCAGTTCAACGAGGTGCACTTCTGGAACGTGCTTCTATTTCAGCGAGAAATAATGTCCCCAATGATCCACTGAGACTATGGCACTTCTAGAGCGCGAAATCGTATTCGTGAGCACCCGAGATTGATTCCAAGGGCTTCAATATCTCCGAATATCTCCGGCTACATCGATTTGGGTAGATACAAGACCGCTGGATCGAAATCGAAGTCTCATCCGTGGGCAGATGTGGGCAGATATTTTCGCCGGTCGCTGGAGCCCAATCATCAGGATCTAAG

Full Affymetrix probeset data:

Annotations for 1626853_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime