FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626854_at:

>probe:Drosophila_2:1626854_at:252:177; Interrogation_Position=119; Antisense; AAACGAGTTGCTTCATCAATCACTA
>probe:Drosophila_2:1626854_at:44:241; Interrogation_Position=136; Antisense; AATCACTATACTTTTGCAGAGGAAT
>probe:Drosophila_2:1626854_at:65:211; Interrogation_Position=216; Antisense; AAGAATCAGTTCTTTGGCGGCTGCT
>probe:Drosophila_2:1626854_at:241:573; Interrogation_Position=234; Antisense; GGCTGCTTTAAGAAGTCCGAACCAT
>probe:Drosophila_2:1626854_at:480:645; Interrogation_Position=25; Antisense; TCATTTTTCGTTCCTAGCTGTTCAA
>probe:Drosophila_2:1626854_at:162:373; Interrogation_Position=281; Antisense; GAAGAGCAAACGCTGTCGGGATCCT
>probe:Drosophila_2:1626854_at:64:547; Interrogation_Position=299; Antisense; GGATCCTTGCAAAGATGGACCCTGT
>probe:Drosophila_2:1626854_at:234:503; Interrogation_Position=322; Antisense; GTCGCCCCGAGAAATAGGATGAATT
>probe:Drosophila_2:1626854_at:365:715; Interrogation_Position=355; Antisense; TTGCACTTACAACTAACGTCACTCT
>probe:Drosophila_2:1626854_at:197:139; Interrogation_Position=370; Antisense; ACGTCACTCTATCCTCGTTTAGTTT
>probe:Drosophila_2:1626854_at:78:149; Interrogation_Position=382; Antisense; CCTCGTTTAGTTTCCATTTCCATAG
>probe:Drosophila_2:1626854_at:145:507; Interrogation_Position=521; Antisense; GTGCTGGTTCGACTTAACATAACAT
>probe:Drosophila_2:1626854_at:185:669; Interrogation_Position=62; Antisense; TACTCAGTTAATTTCTTTCACCAAA
>probe:Drosophila_2:1626854_at:73:565; Interrogation_Position=93; Antisense; GGAATTCTGTTAAAATTTCTGCCCA

Paste this into a BLAST search page for me
AAACGAGTTGCTTCATCAATCACTAAATCACTATACTTTTGCAGAGGAATAAGAATCAGTTCTTTGGCGGCTGCTGGCTGCTTTAAGAAGTCCGAACCATTCATTTTTCGTTCCTAGCTGTTCAAGAAGAGCAAACGCTGTCGGGATCCTGGATCCTTGCAAAGATGGACCCTGTGTCGCCCCGAGAAATAGGATGAATTTTGCACTTACAACTAACGTCACTCTACGTCACTCTATCCTCGTTTAGTTTCCTCGTTTAGTTTCCATTTCCATAGGTGCTGGTTCGACTTAACATAACATTACTCAGTTAATTTCTTTCACCAAAGGAATTCTGTTAAAATTTCTGCCCA

Full Affymetrix probeset data:

Annotations for 1626854_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720