FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626856_at:

>probe:Drosophila_2:1626856_at:387:133; Interrogation_Position=214; Antisense; ACGCTACGTTCGGATACTCATATGA
>probe:Drosophila_2:1626856_at:720:169; Interrogation_Position=286; Antisense; AAAGCGTTAGAATGCCTCAAGTCCA
>probe:Drosophila_2:1626856_at:707:457; Interrogation_Position=325; Antisense; GATTTCTTTGGGTTTTCTACGCGAT
>probe:Drosophila_2:1626856_at:413:279; Interrogation_Position=341; Antisense; CTACGCGATTGAAACCTGTGGTGGA
>probe:Drosophila_2:1626856_at:527:591; Interrogation_Position=408; Antisense; TGTGGATACCGTTTGGGTTCCTCCG
>probe:Drosophila_2:1626856_at:155:631; Interrogation_Position=429; Antisense; TCCGGGCTTAAGTCTACAGCACTTG
>probe:Drosophila_2:1626856_at:53:175; Interrogation_Position=499; Antisense; AAACCCGGCTCTATAGACTTTGTGA
>probe:Drosophila_2:1626856_at:191:721; Interrogation_Position=581; Antisense; TTGCCTGGTGTCTGCGATTGCCGAT
>probe:Drosophila_2:1626856_at:720:463; Interrogation_Position=596; Antisense; GATTGCCGATTGGATCCCTGGGTCT
>probe:Drosophila_2:1626856_at:696:587; Interrogation_Position=632; Antisense; TGGAGTCACATAAACGCCTTGGTCT
>probe:Drosophila_2:1626856_at:206:497; Interrogation_Position=653; Antisense; GTCTCGGCAGCTTGCTGGTGAAGTC
>probe:Drosophila_2:1626856_at:414:529; Interrogation_Position=702; Antisense; GGGAGATCAAGTTTTGGCGCCAGTA
>probe:Drosophila_2:1626856_at:368:195; Interrogation_Position=764; Antisense; AACTGGGTTTCCGTGCTATAGACAA
>probe:Drosophila_2:1626856_at:57:105; Interrogation_Position=783; Antisense; AGACAATACATACTGGGCTGCCTAG

Paste this into a BLAST search page for me
ACGCTACGTTCGGATACTCATATGAAAAGCGTTAGAATGCCTCAAGTCCAGATTTCTTTGGGTTTTCTACGCGATCTACGCGATTGAAACCTGTGGTGGATGTGGATACCGTTTGGGTTCCTCCGTCCGGGCTTAAGTCTACAGCACTTGAAACCCGGCTCTATAGACTTTGTGATTGCCTGGTGTCTGCGATTGCCGATGATTGCCGATTGGATCCCTGGGTCTTGGAGTCACATAAACGCCTTGGTCTGTCTCGGCAGCTTGCTGGTGAAGTCGGGAGATCAAGTTTTGGCGCCAGTAAACTGGGTTTCCGTGCTATAGACAAAGACAATACATACTGGGCTGCCTAG

Full Affymetrix probeset data:

Annotations for 1626856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720