FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626857_at:

>probe:Drosophila_2:1626857_at:605:97; Interrogation_Position=1570; Antisense; AGATGATCATGTTTCCCTACGGACA
>probe:Drosophila_2:1626857_at:312:153; Interrogation_Position=1594; Antisense; ACAGTGCCGAACGTGTGGACAACTA
>probe:Drosophila_2:1626857_at:650:143; Interrogation_Position=1629; Antisense; ACTGATATTGGTAAGCTGGCGGCCA
>probe:Drosophila_2:1626857_at:722:433; Interrogation_Position=1688; Antisense; GAGTGGCAGCATCTACGAGACCATA
>probe:Drosophila_2:1626857_at:119:23; Interrogation_Position=1710; Antisense; ATATATCCCTCATCAGGTGGCTCAA
>probe:Drosophila_2:1626857_at:255:727; Interrogation_Position=1739; Antisense; TTGGGCCCATGGTCAGCTCAAGATA
>probe:Drosophila_2:1626857_at:133:649; Interrogation_Position=1756; Antisense; TCAAGATACCGATTACCTTCTCCTA
>probe:Drosophila_2:1626857_at:59:79; Interrogation_Position=1807; Antisense; AGGATCTGTTCATTTTGTCCGCCAA
>probe:Drosophila_2:1626857_at:385:347; Interrogation_Position=1863; Antisense; GCATCCATCCAAACGATCGTGCAGG
>probe:Drosophila_2:1626857_at:554:71; Interrogation_Position=1888; Antisense; AGGCAGGCAAACGTGGCTATTACCA
>probe:Drosophila_2:1626857_at:416:571; Interrogation_Position=1928; Antisense; GGCTCTAACTGAAATTCCACCATCA
>probe:Drosophila_2:1626857_at:729:603; Interrogation_Position=2011; Antisense; TGATAAATGTCGTCTGGCCATGGCA
>probe:Drosophila_2:1626857_at:395:613; Interrogation_Position=2043; Antisense; TGAAAAACACATTACGCGCCATCGT
>probe:Drosophila_2:1626857_at:409:299; Interrogation_Position=2057; Antisense; CGCGCCATCGTTTCTTAATGCTAAA

Paste this into a BLAST search page for me
AGATGATCATGTTTCCCTACGGACAACAGTGCCGAACGTGTGGACAACTAACTGATATTGGTAAGCTGGCGGCCAGAGTGGCAGCATCTACGAGACCATAATATATCCCTCATCAGGTGGCTCAATTGGGCCCATGGTCAGCTCAAGATATCAAGATACCGATTACCTTCTCCTAAGGATCTGTTCATTTTGTCCGCCAAGCATCCATCCAAACGATCGTGCAGGAGGCAGGCAAACGTGGCTATTACCAGGCTCTAACTGAAATTCCACCATCATGATAAATGTCGTCTGGCCATGGCATGAAAAACACATTACGCGCCATCGTCGCGCCATCGTTTCTTAATGCTAAA

Full Affymetrix probeset data:

Annotations for 1626857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720