FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626859_at:

>probe:Drosophila_2:1626859_at:591:441; Interrogation_Position=332; Antisense; GATGGATTCTAACTGCCCAGCATTG
>probe:Drosophila_2:1626859_at:497:537; Interrogation_Position=377; Antisense; GGTATACTGTTCGAGCGGGATCAAC
>probe:Drosophila_2:1626859_at:143:331; Interrogation_Position=416; Antisense; GCGGTCAACTTCGACATGTTCAGAA
>probe:Drosophila_2:1626859_at:138:177; Interrogation_Position=440; Antisense; AAACTGTGTGCCATCCAAACTATAG
>probe:Drosophila_2:1626859_at:106:173; Interrogation_Position=504; Antisense; AAAGACTCCACTGAATGTCGGCCGG
>probe:Drosophila_2:1626859_at:537:109; Interrogation_Position=536; Antisense; AGAAGGTGAAGCTTCCCTCCACGAG
>probe:Drosophila_2:1626859_at:197:17; Interrogation_Position=570; Antisense; ATTTCCTAAATGTTACCTGGCCAGC
>probe:Drosophila_2:1626859_at:677:511; Interrogation_Position=664; Antisense; GTGAGCCGAGCCAAGTGTCAGCAAG
>probe:Drosophila_2:1626859_at:92:109; Interrogation_Position=743; Antisense; AGAACCGAGATACTTGCTCCGGAGA
>probe:Drosophila_2:1626859_at:430:435; Interrogation_Position=773; Antisense; GAGGTCCACTGGTCCATAATGGCGT
>probe:Drosophila_2:1626859_at:708:227; Interrogation_Position=790; Antisense; AATGGCGTGCTCTACGGAATAACAT
>probe:Drosophila_2:1626859_at:224:717; Interrogation_Position=817; Antisense; TTCGGAATCGGTTGTGCCAGTGCCA
>probe:Drosophila_2:1626859_at:253:307; Interrogation_Position=832; Antisense; GCCAGTGCCAAATATCCGGGTGTAT
>probe:Drosophila_2:1626859_at:709:513; Interrogation_Position=865; Antisense; GTGTTGCAATATACTCGCTGGATTA

Paste this into a BLAST search page for me
GATGGATTCTAACTGCCCAGCATTGGGTATACTGTTCGAGCGGGATCAACGCGGTCAACTTCGACATGTTCAGAAAAACTGTGTGCCATCCAAACTATAGAAAGACTCCACTGAATGTCGGCCGGAGAAGGTGAAGCTTCCCTCCACGAGATTTCCTAAATGTTACCTGGCCAGCGTGAGCCGAGCCAAGTGTCAGCAAGAGAACCGAGATACTTGCTCCGGAGAGAGGTCCACTGGTCCATAATGGCGTAATGGCGTGCTCTACGGAATAACATTTCGGAATCGGTTGTGCCAGTGCCAGCCAGTGCCAAATATCCGGGTGTATGTGTTGCAATATACTCGCTGGATTA

Full Affymetrix probeset data:

Annotations for 1626859_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720