FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626861_at:

>probe:Drosophila_2:1626861_at:672:567; Interrogation_Position=213; Antisense; GGCAGCCTTGTTTGCATTGCAGATT
>probe:Drosophila_2:1626861_at:383:705; Interrogation_Position=253; Antisense; TTAAATTACGCACAGCAGCCGGGAA
>probe:Drosophila_2:1626861_at:701:275; Interrogation_Position=317; Antisense; CTTCTGGCCACGACAATGACATTAC
>probe:Drosophila_2:1626861_at:603:55; Interrogation_Position=332; Antisense; ATGACATTACCCATAACAGCCGCAG
>probe:Drosophila_2:1626861_at:202:709; Interrogation_Position=425; Antisense; TTAACAGGCCACATTTCCACGACAG
>probe:Drosophila_2:1626861_at:142:135; Interrogation_Position=470; Antisense; ACGCCGACGAGCAGTTTGCCTATAA
>probe:Drosophila_2:1626861_at:571:43; Interrogation_Position=496; Antisense; ATCGCAATTTGTGGATGCCTCGTTG
>probe:Drosophila_2:1626861_at:212:317; Interrogation_Position=512; Antisense; GCCTCGTTGACTTCGCTATCATTAA
>probe:Drosophila_2:1626861_at:649:147; Interrogation_Position=582; Antisense; ACTTGTCGTCGGATTCCACGTTTGA
>probe:Drosophila_2:1626861_at:251:425; Interrogation_Position=683; Antisense; GAGAGCTGGCTGGATCTATCGCTGC
>probe:Drosophila_2:1626861_at:376:621; Interrogation_Position=705; Antisense; TGCTGCTGCTCAAAGGATTCATCTT
>probe:Drosophila_2:1626861_at:5:463; Interrogation_Position=720; Antisense; GATTCATCTTCTCGTCAATTATCCT
>probe:Drosophila_2:1626861_at:389:503; Interrogation_Position=752; Antisense; GTCCTCGGCAATGCATTGGTCATCA
>probe:Drosophila_2:1626861_at:236:537; Interrogation_Position=769; Antisense; GGTCATCATTTCAGTGCAGCGCAAT

Paste this into a BLAST search page for me
GGCAGCCTTGTTTGCATTGCAGATTTTAAATTACGCACAGCAGCCGGGAACTTCTGGCCACGACAATGACATTACATGACATTACCCATAACAGCCGCAGTTAACAGGCCACATTTCCACGACAGACGCCGACGAGCAGTTTGCCTATAAATCGCAATTTGTGGATGCCTCGTTGGCCTCGTTGACTTCGCTATCATTAAACTTGTCGTCGGATTCCACGTTTGAGAGAGCTGGCTGGATCTATCGCTGCTGCTGCTGCTCAAAGGATTCATCTTGATTCATCTTCTCGTCAATTATCCTGTCCTCGGCAATGCATTGGTCATCAGGTCATCATTTCAGTGCAGCGCAAT

Full Affymetrix probeset data:

Annotations for 1626861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720