FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626862_at:

>probe:Drosophila_2:1626862_at:266:31; Interrogation_Position=4502; Antisense; ATAAAGGCGTTCTCAGGCATCTGAT
>probe:Drosophila_2:1626862_at:527:457; Interrogation_Position=4524; Antisense; GATAGCCACCAGTCGCAGAGAGAGC
>probe:Drosophila_2:1626862_at:2:279; Interrogation_Position=4585; Antisense; CTTTGGCGGTTTGCTGACAGTGTTT
>probe:Drosophila_2:1626862_at:286:401; Interrogation_Position=4600; Antisense; GACAGTGTTTAGCTGCTTCTGCTCG
>probe:Drosophila_2:1626862_at:185:391; Interrogation_Position=4692; Antisense; GAAAGCTGCATAGCTCTTCAATCCC
>probe:Drosophila_2:1626862_at:174:83; Interrogation_Position=4721; Antisense; AGTGTCCGACCGAGTTCTTCGCTAC
>probe:Drosophila_2:1626862_at:498:619; Interrogation_Position=4754; Antisense; TGCTTTCCCACATGATGGCGCACAG
>probe:Drosophila_2:1626862_at:616:581; Interrogation_Position=4769; Antisense; TGGCGCACAGTGCTCAGGTAGCTCT
>probe:Drosophila_2:1626862_at:415:79; Interrogation_Position=4784; Antisense; AGGTAGCTCTGCAACTTGCTTCGCG
>probe:Drosophila_2:1626862_at:510:723; Interrogation_Position=4799; Antisense; TTGCTTCGCGCTATCTTGATTACAG
>probe:Drosophila_2:1626862_at:82:667; Interrogation_Position=4819; Antisense; TACAGTTTGGGCATTCTTCAGCTCC
>probe:Drosophila_2:1626862_at:182:263; Interrogation_Position=4837; Antisense; CAGCTCCAATCGGAGTAGCTCTGGA
>probe:Drosophila_2:1626862_at:76:675; Interrogation_Position=4852; Antisense; TAGCTCTGGACTCTGCAAGGGCCAA
>probe:Drosophila_2:1626862_at:306:363; Interrogation_Position=4956; Antisense; GAATTGACTCACTAAAACCCTACTT

Paste this into a BLAST search page for me
ATAAAGGCGTTCTCAGGCATCTGATGATAGCCACCAGTCGCAGAGAGAGCCTTTGGCGGTTTGCTGACAGTGTTTGACAGTGTTTAGCTGCTTCTGCTCGGAAAGCTGCATAGCTCTTCAATCCCAGTGTCCGACCGAGTTCTTCGCTACTGCTTTCCCACATGATGGCGCACAGTGGCGCACAGTGCTCAGGTAGCTCTAGGTAGCTCTGCAACTTGCTTCGCGTTGCTTCGCGCTATCTTGATTACAGTACAGTTTGGGCATTCTTCAGCTCCCAGCTCCAATCGGAGTAGCTCTGGATAGCTCTGGACTCTGCAAGGGCCAAGAATTGACTCACTAAAACCCTACTT

Full Affymetrix probeset data:

Annotations for 1626862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720