FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626864_at:

>probe:Drosophila_2:1626864_at:206:1; Interrogation_Position=2012; Antisense; AAAACGGACTCGTGGTCACTCTACG
>probe:Drosophila_2:1626864_at:494:197; Interrogation_Position=2014; Antisense; AACGGACTCGTGGTCACTCTACGCA
>probe:Drosophila_2:1626864_at:608:555; Interrogation_Position=2017; Antisense; GGACTCGTGGTCACTCTACGCACCA
>probe:Drosophila_2:1626864_at:633:637; Interrogation_Position=2021; Antisense; TCGTGGTCACTCTACGCACCAGCGG
>probe:Drosophila_2:1626864_at:63:355; Interrogation_Position=2036; Antisense; GCACCAGCGGCACGGAGCCCAAGAT
>probe:Drosophila_2:1626864_at:674:217; Interrogation_Position=2062; Antisense; AAGTACTACGCCGAAATGTGTGGCA
>probe:Drosophila_2:1626864_at:466:671; Interrogation_Position=2068; Antisense; TACGCCGAAATGTGTGGCAAGCCGG
>probe:Drosophila_2:1626864_at:231:169; Interrogation_Position=2075; Antisense; AAATGTGTGGCAAGCCGGACGAGAA
>probe:Drosophila_2:1626864_at:17:595; Interrogation_Position=2080; Antisense; TGTGGCAAGCCGGACGAGAAAAACT
>probe:Drosophila_2:1626864_at:635:287; Interrogation_Position=2090; Antisense; CGGACGAGAAAAACTGGGCCAAGCT
>probe:Drosophila_2:1626864_at:31:183; Interrogation_Position=2099; Antisense; AAAACTGGGCCAAGCTGACTAATAC
>probe:Drosophila_2:1626864_at:226:141; Interrogation_Position=2102; Antisense; ACTGGGCCAAGCTGACTAATACAAT
>probe:Drosophila_2:1626864_at:525:579; Interrogation_Position=2106; Antisense; GGCCAAGCTGACTAATACAATGAAT
>probe:Drosophila_2:1626864_at:656:159; Interrogation_Position=2122; Antisense; ACAATGAATACCATGGTGGAGGCCA

Paste this into a BLAST search page for me
AAAACGGACTCGTGGTCACTCTACGAACGGACTCGTGGTCACTCTACGCAGGACTCGTGGTCACTCTACGCACCATCGTGGTCACTCTACGCACCAGCGGGCACCAGCGGCACGGAGCCCAAGATAAGTACTACGCCGAAATGTGTGGCATACGCCGAAATGTGTGGCAAGCCGGAAATGTGTGGCAAGCCGGACGAGAATGTGGCAAGCCGGACGAGAAAAACTCGGACGAGAAAAACTGGGCCAAGCTAAAACTGGGCCAAGCTGACTAATACACTGGGCCAAGCTGACTAATACAATGGCCAAGCTGACTAATACAATGAATACAATGAATACCATGGTGGAGGCCA

Full Affymetrix probeset data:

Annotations for 1626864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720