FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626866_at:

>probe:Drosophila_2:1626866_at:634:553; Interrogation_Position=117; Antisense; GGACGAGATCGAGAAACTGTTCAAC
>probe:Drosophila_2:1626866_at:652:141; Interrogation_Position=132; Antisense; ACTGTTCAACAGTAAGGAGCCGCTG
>probe:Drosophila_2:1626866_at:137:555; Interrogation_Position=147; Antisense; GGAGCCGCTGACTGAAGAACGAATC
>probe:Drosophila_2:1626866_at:429:535; Interrogation_Position=15; Antisense; GGTGCAGACCATTTTCTGGCTACCT
>probe:Drosophila_2:1626866_at:139:383; Interrogation_Position=163; Antisense; GAACGAATCAACCAGTTGCTCGACA
>probe:Drosophila_2:1626866_at:607:33; Interrogation_Position=169; Antisense; ATCAACCAGTTGCTCGACAAGCCAG
>probe:Drosophila_2:1626866_at:79:469; Interrogation_Position=177; Antisense; GTTGCTCGACAAGCCAGAGACTTCA
>probe:Drosophila_2:1626866_at:562:271; Interrogation_Position=197; Antisense; CTTCAGAGCCAAAAAAGGAGCAATA
>probe:Drosophila_2:1626866_at:602:103; Interrogation_Position=20; Antisense; AGACCATTTTCTGGCTACCTGGACA
>probe:Drosophila_2:1626866_at:188:699; Interrogation_Position=26; Antisense; TTTTCTGGCTACCTGGACATCTGAA
>probe:Drosophila_2:1626866_at:48:571; Interrogation_Position=32; Antisense; GGCTACCTGGACATCTGAAGAAGAA
>probe:Drosophila_2:1626866_at:160:643; Interrogation_Position=45; Antisense; TCTGAAGAAGAACCAGCAGCGCCTG
>probe:Drosophila_2:1626866_at:42:437; Interrogation_Position=70; Antisense; GAGGATCTGGCCAAAATCTATGCCA
>probe:Drosophila_2:1626866_at:131:645; Interrogation_Position=86; Antisense; TCTATGCCAAGGATATTAGCGAGGA

Paste this into a BLAST search page for me
GGACGAGATCGAGAAACTGTTCAACACTGTTCAACAGTAAGGAGCCGCTGGGAGCCGCTGACTGAAGAACGAATCGGTGCAGACCATTTTCTGGCTACCTGAACGAATCAACCAGTTGCTCGACAATCAACCAGTTGCTCGACAAGCCAGGTTGCTCGACAAGCCAGAGACTTCACTTCAGAGCCAAAAAAGGAGCAATAAGACCATTTTCTGGCTACCTGGACATTTTCTGGCTACCTGGACATCTGAAGGCTACCTGGACATCTGAAGAAGAATCTGAAGAAGAACCAGCAGCGCCTGGAGGATCTGGCCAAAATCTATGCCATCTATGCCAAGGATATTAGCGAGGA

Full Affymetrix probeset data:

Annotations for 1626866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720