FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626867_at:

>probe:Drosophila_2:1626867_at:51:549; Interrogation_Position=112; Antisense; GGAGGTGTGAAGAAGCCCCACCGCT
>probe:Drosophila_2:1626867_at:589:65; Interrogation_Position=13; Antisense; ATGGCTCGTACCAAGCAAACTGCTC
>probe:Drosophila_2:1626867_at:73:639; Interrogation_Position=18; Antisense; TCGTACCAAGCAAACTGCTCGCAAA
>probe:Drosophila_2:1626867_at:118:359; Interrogation_Position=27; Antisense; GCAAACTGCTCGCAAATCGACTGGT
>probe:Drosophila_2:1626867_at:118:195; Interrogation_Position=30; Antisense; AACTGCTCGCAAATCGACTGGTGGA
>probe:Drosophila_2:1626867_at:691:43; Interrogation_Position=42; Antisense; ATCGACTGGTGGAAAGGCGCCACGC
>probe:Drosophila_2:1626867_at:229:585; Interrogation_Position=51; Antisense; TGGAAAGGCGCCACGCAAACAACTG
>probe:Drosophila_2:1626867_at:183:227; Interrogation_Position=55; Antisense; AAGGCGCCACGCAAACAACTGGCTA
>probe:Drosophila_2:1626867_at:689:179; Interrogation_Position=67; Antisense; AAACAACTGGCTACTAAGGCCGCTC
>probe:Drosophila_2:1626867_at:67:197; Interrogation_Position=71; Antisense; AACTGGCTACTAAGGCCGCTCGCAA
>probe:Drosophila_2:1626867_at:239:669; Interrogation_Position=78; Antisense; TACTAAGGCCGCTCGCAAGAGTGCT
>probe:Drosophila_2:1626867_at:279:227; Interrogation_Position=82; Antisense; AAGGCCGCTCGCAAGAGTGCTCCAG
>probe:Drosophila_2:1626867_at:134:215; Interrogation_Position=94; Antisense; AAGAGTGCTCCAGCCACCGGAGGTG
>probe:Drosophila_2:1626867_at:469:83; Interrogation_Position=97; Antisense; AGTGCTCCAGCCACCGGAGGTGTGA

Paste this into a BLAST search page for me
GGAGGTGTGAAGAAGCCCCACCGCTATGGCTCGTACCAAGCAAACTGCTCTCGTACCAAGCAAACTGCTCGCAAAGCAAACTGCTCGCAAATCGACTGGTAACTGCTCGCAAATCGACTGGTGGAATCGACTGGTGGAAAGGCGCCACGCTGGAAAGGCGCCACGCAAACAACTGAAGGCGCCACGCAAACAACTGGCTAAAACAACTGGCTACTAAGGCCGCTCAACTGGCTACTAAGGCCGCTCGCAATACTAAGGCCGCTCGCAAGAGTGCTAAGGCCGCTCGCAAGAGTGCTCCAGAAGAGTGCTCCAGCCACCGGAGGTGAGTGCTCCAGCCACCGGAGGTGTGA

Full Affymetrix probeset data:

Annotations for 1626867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720