FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626871_at:

>probe:Drosophila_2:1626871_at:718:705; Interrogation_Position=258; Antisense; TTAGCCTGCACGGTATCTCTTCGAA
>probe:Drosophila_2:1626871_at:436:85; Interrogation_Position=291; Antisense; AGTGCATCTACTTCATGCTGGACCA
>probe:Drosophila_2:1626871_at:13:257; Interrogation_Position=316; Antisense; CAAAGTCGAGTGGAACGGCGTCTAC
>probe:Drosophila_2:1626871_at:524:263; Interrogation_Position=353; Antisense; CAGCAGGCAGTCAATGGTCGGAATG
>probe:Drosophila_2:1626871_at:308:79; Interrogation_Position=474; Antisense; AGGTCACAGAGTGCTGGCTTATGCC
>probe:Drosophila_2:1626871_at:599:581; Interrogation_Position=488; Antisense; TGGCTTATGCCGGAGGACATTCACA
>probe:Drosophila_2:1626871_at:340:73; Interrogation_Position=501; Antisense; AGGACATTCACACCGTAGACACTAT
>probe:Drosophila_2:1626871_at:39:601; Interrogation_Position=525; Antisense; TGTACAGTGCCATGACGACTTGCCA
>probe:Drosophila_2:1626871_at:673:69; Interrogation_Position=549; Antisense; AGGCCCTACATCCTGATTCGGCAAA
>probe:Drosophila_2:1626871_at:2:515; Interrogation_Position=576; Antisense; GTGATTCGGAAGACAGCGATCCTAT
>probe:Drosophila_2:1626871_at:377:627; Interrogation_Position=595; Antisense; TCCTATGCAGGATGCCGGTGGCTTA
>probe:Drosophila_2:1626871_at:133:445; Interrogation_Position=641; Antisense; GATGATGCATTGACGCTTGGGCGCA
>probe:Drosophila_2:1626871_at:563:523; Interrogation_Position=659; Antisense; GGGCGCAACGGCGTGCAGAATCTCA
>probe:Drosophila_2:1626871_at:714:263; Interrogation_Position=674; Antisense; CAGAATCTCAGTTTGGACGACGACG

Paste this into a BLAST search page for me
TTAGCCTGCACGGTATCTCTTCGAAAGTGCATCTACTTCATGCTGGACCACAAAGTCGAGTGGAACGGCGTCTACCAGCAGGCAGTCAATGGTCGGAATGAGGTCACAGAGTGCTGGCTTATGCCTGGCTTATGCCGGAGGACATTCACAAGGACATTCACACCGTAGACACTATTGTACAGTGCCATGACGACTTGCCAAGGCCCTACATCCTGATTCGGCAAAGTGATTCGGAAGACAGCGATCCTATTCCTATGCAGGATGCCGGTGGCTTAGATGATGCATTGACGCTTGGGCGCAGGGCGCAACGGCGTGCAGAATCTCACAGAATCTCAGTTTGGACGACGACG

Full Affymetrix probeset data:

Annotations for 1626871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720