FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626872_at:

>probe:Drosophila_2:1626872_at:675:49; Interrogation_Position=13; Antisense; ATGCCGTACGAGTCGATGCACCATC
>probe:Drosophila_2:1626872_at:692:43; Interrogation_Position=139; Antisense; ATCGAGCGGGCGCATCAGGAAACCC
>probe:Drosophila_2:1626872_at:65:561; Interrogation_Position=156; Antisense; GGAAACCCTGGCACAAATACGCAAT
>probe:Drosophila_2:1626872_at:380:241; Interrogation_Position=171; Antisense; AATACGCAATCTGAGCGGTAGCGCT
>probe:Drosophila_2:1626872_at:331:367; Interrogation_Position=219; Antisense; GAATCTGCAGTCGAGAGCCCGGGAA
>probe:Drosophila_2:1626872_at:407:139; Interrogation_Position=243; Antisense; ACTGGAAAAGAAGGTTGCGCTGGAA
>probe:Drosophila_2:1626872_at:124:419; Interrogation_Position=283; Antisense; GAGCTGCAAATCGAACTGACGTCGG
>probe:Drosophila_2:1626872_at:106:43; Interrogation_Position=292; Antisense; ATCGAACTGACGTCGGCTCTGAAGG
>probe:Drosophila_2:1626872_at:263:533; Interrogation_Position=367; Antisense; GGTGGCGGCGCGACCATTCCTACAT
>probe:Drosophila_2:1626872_at:149:289; Interrogation_Position=408; Antisense; CGTCACTTGGGCACCGACAATCAGC
>probe:Drosophila_2:1626872_at:281:397; Interrogation_Position=423; Antisense; GACAATCAGCCACCAGGACCAAGGA
>probe:Drosophila_2:1626872_at:717:413; Interrogation_Position=439; Antisense; GACCAAGGATCCGAGATTGATATCA
>probe:Drosophila_2:1626872_at:341:309; Interrogation_Position=77; Antisense; CCAACGGAATGCTGGACGCCCTCAG
>probe:Drosophila_2:1626872_at:58:651; Interrogation_Position=98; Antisense; TCAGCCTGCAGCTGCGCGATGCCGA

Paste this into a BLAST search page for me
ATGCCGTACGAGTCGATGCACCATCATCGAGCGGGCGCATCAGGAAACCCGGAAACCCTGGCACAAATACGCAATAATACGCAATCTGAGCGGTAGCGCTGAATCTGCAGTCGAGAGCCCGGGAAACTGGAAAAGAAGGTTGCGCTGGAAGAGCTGCAAATCGAACTGACGTCGGATCGAACTGACGTCGGCTCTGAAGGGGTGGCGGCGCGACCATTCCTACATCGTCACTTGGGCACCGACAATCAGCGACAATCAGCCACCAGGACCAAGGAGACCAAGGATCCGAGATTGATATCACCAACGGAATGCTGGACGCCCTCAGTCAGCCTGCAGCTGCGCGATGCCGA

Full Affymetrix probeset data:

Annotations for 1626872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720