Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626873_a_at:

>probe:Drosophila_2:1626873_a_at:354:273; Interrogation_Position=234; Antisense; CATTAGCAAGTGGTGGCGTGGTTTC
>probe:Drosophila_2:1626873_a_at:140:519; Interrogation_Position=251; Antisense; GTGGTTTCTGGGTGCGACACTCAAA
>probe:Drosophila_2:1626873_a_at:238:471; Interrogation_Position=276; Antisense; GTTCTCCTTTATGCAACAGCTGTTA
>probe:Drosophila_2:1626873_a_at:198:437; Interrogation_Position=306; Antisense; GAGGATCATCCAGTATCACCACGAT
>probe:Drosophila_2:1626873_a_at:363:329; Interrogation_Position=359; Antisense; GCGGATGGATGACTCGCCAGTACTT
>probe:Drosophila_2:1626873_a_at:607:89; Interrogation_Position=377; Antisense; AGTACTTCCAGGACTTCCAGGGCAT
>probe:Drosophila_2:1626873_a_at:400:219; Interrogation_Position=403; Antisense; AAGTCGCTCCGAATACAGTATGTGG
>probe:Drosophila_2:1626873_a_at:529:95; Interrogation_Position=429; Antisense; AGATATGCTCAGTTCGCTTTACAGA
>probe:Drosophila_2:1626873_a_at:335:449; Interrogation_Position=528; Antisense; GATCGAGGACCTTTCTAGTACCTTT
>probe:Drosophila_2:1626873_a_at:13:489; Interrogation_Position=545; Antisense; GTACCTTTGGCTACCGCTTTCATAA
>probe:Drosophila_2:1626873_a_at:575:377; Interrogation_Position=597; Antisense; GAAGCGATCCTTCATAAACGACCGG
>probe:Drosophila_2:1626873_a_at:423:199; Interrogation_Position=613; Antisense; AACGACCGGCGACATGAGTTCCGAA
>probe:Drosophila_2:1626873_a_at:582:273; Interrogation_Position=647; Antisense; CTTATTCCAAAGTGCCTTATCCGGG
>probe:Drosophila_2:1626873_a_at:163:369; Interrogation_Position=719; Antisense; GAATGACACCACGTTTGCAGCGTAC

Paste this into a BLAST search page for me
CATTAGCAAGTGGTGGCGTGGTTTCGTGGTTTCTGGGTGCGACACTCAAAGTTCTCCTTTATGCAACAGCTGTTAGAGGATCATCCAGTATCACCACGATGCGGATGGATGACTCGCCAGTACTTAGTACTTCCAGGACTTCCAGGGCATAAGTCGCTCCGAATACAGTATGTGGAGATATGCTCAGTTCGCTTTACAGAGATCGAGGACCTTTCTAGTACCTTTGTACCTTTGGCTACCGCTTTCATAAGAAGCGATCCTTCATAAACGACCGGAACGACCGGCGACATGAGTTCCGAACTTATTCCAAAGTGCCTTATCCGGGGAATGACACCACGTTTGCAGCGTAC

Full Affymetrix probeset data:

Annotations for 1626873_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime