Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626874_at:

>probe:Drosophila_2:1626874_at:556:65; Interrogation_Position=2438; Antisense; ATGGTATTTACAACAGGACTGCAAA
>probe:Drosophila_2:1626874_at:177:405; Interrogation_Position=2454; Antisense; GACTGCAAAGGCAAAGCAAGTTTAA
>probe:Drosophila_2:1626874_at:652:411; Interrogation_Position=2497; Antisense; GACCGAATCAAATTAAACTCTAGCC
>probe:Drosophila_2:1626874_at:216:663; Interrogation_Position=2510; Antisense; TAAACTCTAGCCCAAAACATTGAAT
>probe:Drosophila_2:1626874_at:397:485; Interrogation_Position=2551; Antisense; GTATGTATGTACTTCGATGCAAGTA
>probe:Drosophila_2:1626874_at:226:443; Interrogation_Position=2566; Antisense; GATGCAAGTAGTTTTTTATGACCTC
>probe:Drosophila_2:1626874_at:493:53; Interrogation_Position=2583; Antisense; ATGACCTCTTAATGTGCTTACCAAC
>probe:Drosophila_2:1626874_at:270:341; Interrogation_Position=2598; Antisense; GCTTACCAACTATATGCAGGACTAT
>probe:Drosophila_2:1626874_at:140:349; Interrogation_Position=2613; Antisense; GCAGGACTATATACCTACCCAACAA
>probe:Drosophila_2:1626874_at:106:673; Interrogation_Position=2624; Antisense; TACCTACCCAACAATATTACTACTT
>probe:Drosophila_2:1626874_at:153:707; Interrogation_Position=2640; Antisense; TTACTACTTATATACACGATTACTG
>probe:Drosophila_2:1626874_at:315:399; Interrogation_Position=2744; Antisense; GACACTATCTGTATGCGTACCTAAA
>probe:Drosophila_2:1626874_at:673:663; Interrogation_Position=2811; Antisense; TAAATGCGATTTCGATTCGGAAAAC
>probe:Drosophila_2:1626874_at:568:651; Interrogation_Position=2826; Antisense; TTCGGAAAACGAGATGTGGCATAAT

Paste this into a BLAST search page for me
ATGGTATTTACAACAGGACTGCAAAGACTGCAAAGGCAAAGCAAGTTTAAGACCGAATCAAATTAAACTCTAGCCTAAACTCTAGCCCAAAACATTGAATGTATGTATGTACTTCGATGCAAGTAGATGCAAGTAGTTTTTTATGACCTCATGACCTCTTAATGTGCTTACCAACGCTTACCAACTATATGCAGGACTATGCAGGACTATATACCTACCCAACAATACCTACCCAACAATATTACTACTTTTACTACTTATATACACGATTACTGGACACTATCTGTATGCGTACCTAAATAAATGCGATTTCGATTCGGAAAACTTCGGAAAACGAGATGTGGCATAAT

Full Affymetrix probeset data:

Annotations for 1626874_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime