FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626875_at:

>probe:Drosophila_2:1626875_at:194:191; Interrogation_Position=1671; Antisense; AACTTCGCGGTCTGGTCGTATGGCA
>probe:Drosophila_2:1626875_at:80:697; Interrogation_Position=1701; Antisense; TTTCTCACCTCGTTTCAGGGATTTT
>probe:Drosophila_2:1626875_at:213:435; Interrogation_Position=1758; Antisense; GAGGTTCGTGCCGTGCTACTAAAGA
>probe:Drosophila_2:1626875_at:614:337; Interrogation_Position=1772; Antisense; GCTACTAAAGAGTCTGGCCACCCAG
>probe:Drosophila_2:1626875_at:365:79; Interrogation_Position=1808; Antisense; AGGTCATCCGGAATGGGCGCCGAAA
>probe:Drosophila_2:1626875_at:52:347; Interrogation_Position=1836; Antisense; GCATCTATGTACTCGGGTGCTTATA
>probe:Drosophila_2:1626875_at:239:533; Interrogation_Position=1851; Antisense; GGTGCTTATAACACGGCGCCGGATA
>probe:Drosophila_2:1626875_at:382:349; Interrogation_Position=1893; Antisense; GCAGGAGATCCATCGGCCACTGGAA
>probe:Drosophila_2:1626875_at:354:391; Interrogation_Position=1954; Antisense; GAAAGCCGAGCAGTGCCAGCATTGT
>probe:Drosophila_2:1626875_at:109:597; Interrogation_Position=1976; Antisense; TGTGATGATTCACGAGCCTCAACAG
>probe:Drosophila_2:1626875_at:271:383; Interrogation_Position=2140; Antisense; GAACTCGCGGCTCCAAGTGGATAAT
>probe:Drosophila_2:1626875_at:670:585; Interrogation_Position=2157; Antisense; TGGATAATGGGCATCTGCTTCCGGG
>probe:Drosophila_2:1626875_at:611:655; Interrogation_Position=2194; Antisense; TAAGAGTACCGTCAGCGTCATCCGT
>probe:Drosophila_2:1626875_at:40:507; Interrogation_Position=2217; Antisense; GTGCCACCCGAGTCAGTTGTATTTG

Paste this into a BLAST search page for me
AACTTCGCGGTCTGGTCGTATGGCATTTCTCACCTCGTTTCAGGGATTTTGAGGTTCGTGCCGTGCTACTAAAGAGCTACTAAAGAGTCTGGCCACCCAGAGGTCATCCGGAATGGGCGCCGAAAGCATCTATGTACTCGGGTGCTTATAGGTGCTTATAACACGGCGCCGGATAGCAGGAGATCCATCGGCCACTGGAAGAAAGCCGAGCAGTGCCAGCATTGTTGTGATGATTCACGAGCCTCAACAGGAACTCGCGGCTCCAAGTGGATAATTGGATAATGGGCATCTGCTTCCGGGTAAGAGTACCGTCAGCGTCATCCGTGTGCCACCCGAGTCAGTTGTATTTG

Full Affymetrix probeset data:

Annotations for 1626875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720