FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626878_at:

>probe:Drosophila_2:1626878_at:328:201; Interrogation_Position=1284; Antisense; AACGCCGTCGTACAGTCGAGCAGGA
>probe:Drosophila_2:1626878_at:479:349; Interrogation_Position=1303; Antisense; GCAGGATCGCAGGAGTCGACGCACA
>probe:Drosophila_2:1626878_at:250:569; Interrogation_Position=1394; Antisense; GGCATCGAAGGAAGCTGTTCAGCCT
>probe:Drosophila_2:1626878_at:64:631; Interrogation_Position=1491; Antisense; TCCATCCGGCGGAAGTAGCAATGAT
>probe:Drosophila_2:1626878_at:347:589; Interrogation_Position=1547; Antisense; TGGTGCGGAGTCTTAATCCGTTCCT
>probe:Drosophila_2:1626878_at:91:625; Interrogation_Position=1571; Antisense; TGCCCAGCGTTACGTCGCCGAAGAA
>probe:Drosophila_2:1626878_at:683:109; Interrogation_Position=1592; Antisense; AGAAGGCGCCGCACAAGCAGTCGGC
>probe:Drosophila_2:1626878_at:581:609; Interrogation_Position=1637; Antisense; TGACCCCTGACCTTAGCACAAAACG
>probe:Drosophila_2:1626878_at:489:631; Interrogation_Position=1673; Antisense; TCCGGGCCACTATGAAGATCTGCTT
>probe:Drosophila_2:1626878_at:401:55; Interrogation_Position=1684; Antisense; ATGAAGATCTGCTTGGTCGTCTCTC
>probe:Drosophila_2:1626878_at:707:359; Interrogation_Position=1718; Antisense; GCAAGCTGCAGGTGAGTCGCGAAAT
>probe:Drosophila_2:1626878_at:72:239; Interrogation_Position=1740; Antisense; AATAACTGCTGGATTACCCGGTGAT
>probe:Drosophila_2:1626878_at:601:537; Interrogation_Position=1783; Antisense; GGTCATCAAATTATGCGCGGGCCTA
>probe:Drosophila_2:1626878_at:717:321; Interrogation_Position=1797; Antisense; GCGCGGGCCTAATCAAATGTTTACT

Paste this into a BLAST search page for me
AACGCCGTCGTACAGTCGAGCAGGAGCAGGATCGCAGGAGTCGACGCACAGGCATCGAAGGAAGCTGTTCAGCCTTCCATCCGGCGGAAGTAGCAATGATTGGTGCGGAGTCTTAATCCGTTCCTTGCCCAGCGTTACGTCGCCGAAGAAAGAAGGCGCCGCACAAGCAGTCGGCTGACCCCTGACCTTAGCACAAAACGTCCGGGCCACTATGAAGATCTGCTTATGAAGATCTGCTTGGTCGTCTCTCGCAAGCTGCAGGTGAGTCGCGAAATAATAACTGCTGGATTACCCGGTGATGGTCATCAAATTATGCGCGGGCCTAGCGCGGGCCTAATCAAATGTTTACT

Full Affymetrix probeset data:

Annotations for 1626878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720