FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626879_at:

>probe:Drosophila_2:1626879_at:337:195; Interrogation_Position=121; Antisense; AACTGTCAGCCAACTACTACGACCA
>probe:Drosophila_2:1626879_at:226:53; Interrogation_Position=13; Antisense; ATGAAAACCCTCGAGTCCGACGACA
>probe:Drosophila_2:1626879_at:664:127; Interrogation_Position=145; Antisense; ACCAATGGTTCTCCAACGGATGCAA
>probe:Drosophila_2:1626879_at:334:545; Interrogation_Position=162; Antisense; GGATGCAACGGATCCCAACAGTTTG
>probe:Drosophila_2:1626879_at:252:189; Interrogation_Position=178; Antisense; AACAGTTTGCCCAGCGGAGCTGCGG
>probe:Drosophila_2:1626879_at:125:331; Interrogation_Position=203; Antisense; GCGGCATGGTAATCGTGGCCAACAT
>probe:Drosophila_2:1626879_at:294:21; Interrogation_Position=226; Antisense; ATATATAGCACCGTCGAGGTCCTGG
>probe:Drosophila_2:1626879_at:257:35; Interrogation_Position=293; Antisense; ATCAGGGTGCGTCGTCTTCCAACAA
>probe:Drosophila_2:1626879_at:671:253; Interrogation_Position=312; Antisense; CAACAACACCACATGCAAGCCGTAT
>probe:Drosophila_2:1626879_at:717:615; Interrogation_Position=325; Antisense; TGCAAGCCGTATCCCTGCATGGAGG
>probe:Drosophila_2:1626879_at:228:271; Interrogation_Position=357; Antisense; CATCGATGGTCCTGGCTGTGGTTAG
>probe:Drosophila_2:1626879_at:151:175; Interrogation_Position=37; Antisense; AAACCCTTCAATCCCTTCTACATTG
>probe:Drosophila_2:1626879_at:493:227; Interrogation_Position=76; Antisense; AAGGCGTGTGCCATTCCCGAGATTC
>probe:Drosophila_2:1626879_at:15:429; Interrogation_Position=94; Antisense; GAGATTCCCGGCCAGCAATGCTCAC

Paste this into a BLAST search page for me
AACTGTCAGCCAACTACTACGACCAATGAAAACCCTCGAGTCCGACGACAACCAATGGTTCTCCAACGGATGCAAGGATGCAACGGATCCCAACAGTTTGAACAGTTTGCCCAGCGGAGCTGCGGGCGGCATGGTAATCGTGGCCAACATATATATAGCACCGTCGAGGTCCTGGATCAGGGTGCGTCGTCTTCCAACAACAACAACACCACATGCAAGCCGTATTGCAAGCCGTATCCCTGCATGGAGGCATCGATGGTCCTGGCTGTGGTTAGAAACCCTTCAATCCCTTCTACATTGAAGGCGTGTGCCATTCCCGAGATTCGAGATTCCCGGCCAGCAATGCTCAC

Full Affymetrix probeset data:

Annotations for 1626879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720