FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626880_at:

>probe:Drosophila_2:1626880_at:641:311; Interrogation_Position=1443; Antisense; GCCAACGGCGAAACCTGTGTGATTT
>probe:Drosophila_2:1626880_at:499:285; Interrogation_Position=1457; Antisense; CTGTGTGATTTCTACGCCTGTGAAG
>probe:Drosophila_2:1626880_at:2:95; Interrogation_Position=1480; Antisense; AGATACCAGTAGATGCGTCCGTTTC
>probe:Drosophila_2:1626880_at:329:603; Interrogation_Position=1507; Antisense; TGCTTAAAGCAGAGGCCCGGTCCTA
>probe:Drosophila_2:1626880_at:40:101; Interrogation_Position=1555; Antisense; AGAGGCGGCGACTAATCCATGGCGT
>probe:Drosophila_2:1626880_at:474:235; Interrogation_Position=1568; Antisense; AATCCATGGCGTCCTCGTAATGAAG
>probe:Drosophila_2:1626880_at:261:617; Interrogation_Position=1609; Antisense; TGCAAAACCTAACCGATGCCCTGAA
>probe:Drosophila_2:1626880_at:139:105; Interrogation_Position=1719; Antisense; AGACTGAAGACTCTGCTCGAAGAAA
>probe:Drosophila_2:1626880_at:101:77; Interrogation_Position=1771; Antisense; AGGAGAACGGCTCCATAGCCATCGA
>probe:Drosophila_2:1626880_at:473:27; Interrogation_Position=1785; Antisense; ATAGCCATCGAATCCGTTGAGGTGA
>probe:Drosophila_2:1626880_at:97:521; Interrogation_Position=1859; Antisense; GTGGACCAACCAGGACGAGGACATT
>probe:Drosophila_2:1626880_at:584:557; Interrogation_Position=1877; Antisense; GGACATTGGAGCCTACATACTGAAT
>probe:Drosophila_2:1626880_at:337:107; Interrogation_Position=1930; Antisense; AGAAGCATCCCATTGAAATCCCACG
>probe:Drosophila_2:1626880_at:32:635; Interrogation_Position=1948; Antisense; TCCCACGCCTTAATTCCATAGATAA

Paste this into a BLAST search page for me
GCCAACGGCGAAACCTGTGTGATTTCTGTGTGATTTCTACGCCTGTGAAGAGATACCAGTAGATGCGTCCGTTTCTGCTTAAAGCAGAGGCCCGGTCCTAAGAGGCGGCGACTAATCCATGGCGTAATCCATGGCGTCCTCGTAATGAAGTGCAAAACCTAACCGATGCCCTGAAAGACTGAAGACTCTGCTCGAAGAAAAGGAGAACGGCTCCATAGCCATCGAATAGCCATCGAATCCGTTGAGGTGAGTGGACCAACCAGGACGAGGACATTGGACATTGGAGCCTACATACTGAATAGAAGCATCCCATTGAAATCCCACGTCCCACGCCTTAATTCCATAGATAA

Full Affymetrix probeset data:

Annotations for 1626880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720