FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626881_at:

>probe:Drosophila_2:1626881_at:143:75; Interrogation_Position=1804; Antisense; AGGAGCACTAGCAGCCATGCGGGCC
>probe:Drosophila_2:1626881_at:529:605; Interrogation_Position=1849; Antisense; TGATCAGCTCTACTACATGCAGGGC
>probe:Drosophila_2:1626881_at:659:53; Interrogation_Position=1884; Antisense; ATGAACTGCGTCTACTGCAGCAGCA
>probe:Drosophila_2:1626881_at:154:555; Interrogation_Position=1924; Antisense; GGACCTCGAGATCCTTAAGACGCCG
>probe:Drosophila_2:1626881_at:188:659; Interrogation_Position=1939; Antisense; TAAGACGCCGGAAATCTTCATCACC
>probe:Drosophila_2:1626881_at:294:529; Interrogation_Position=2008; Antisense; GGGATTCTCGGACATCATTATCAAA
>probe:Drosophila_2:1626881_at:594:31; Interrogation_Position=2027; Antisense; ATCAAACGATTGCACACGCTATCCG
>probe:Drosophila_2:1626881_at:138:647; Interrogation_Position=2121; Antisense; TCATTTCCCAGATCGTGCTGCAAAA
>probe:Drosophila_2:1626881_at:417:491; Interrogation_Position=2158; Antisense; GTACAAAACCATTCGATCATCGGAG
>probe:Drosophila_2:1626881_at:6:37; Interrogation_Position=2173; Antisense; ATCATCGGAGCTTTCTGCCAAACTG
>probe:Drosophila_2:1626881_at:603:177; Interrogation_Position=2192; Antisense; AAACTGGCACGTGCTCGCCAAAAGG
>probe:Drosophila_2:1626881_at:329:227; Interrogation_Position=2213; Antisense; AAGGCCGATCAGTCCAATGGCAATC
>probe:Drosophila_2:1626881_at:413:583; Interrogation_Position=2230; Antisense; TGGCAATCCCAACGAGGTCTTCTAA
>probe:Drosophila_2:1626881_at:152:659; Interrogation_Position=2252; Antisense; TAAGACTCCCAGTATCCCGAGTTTT

Paste this into a BLAST search page for me
AGGAGCACTAGCAGCCATGCGGGCCTGATCAGCTCTACTACATGCAGGGCATGAACTGCGTCTACTGCAGCAGCAGGACCTCGAGATCCTTAAGACGCCGTAAGACGCCGGAAATCTTCATCACCGGGATTCTCGGACATCATTATCAAAATCAAACGATTGCACACGCTATCCGTCATTTCCCAGATCGTGCTGCAAAAGTACAAAACCATTCGATCATCGGAGATCATCGGAGCTTTCTGCCAAACTGAAACTGGCACGTGCTCGCCAAAAGGAAGGCCGATCAGTCCAATGGCAATCTGGCAATCCCAACGAGGTCTTCTAATAAGACTCCCAGTATCCCGAGTTTT

Full Affymetrix probeset data:

Annotations for 1626881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720