FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626882_at:

>probe:Drosophila_2:1626882_at:378:155; Interrogation_Position=396; Antisense; ACAGAAGATCTCGATCGGCTTCGCG
>probe:Drosophila_2:1626882_at:532:41; Interrogation_Position=409; Antisense; ATCGGCTTCGCGTGGGTGATTTCAA
>probe:Drosophila_2:1626882_at:651:591; Interrogation_Position=421; Antisense; TGGGTGATTTCAACTTTCCGCCATC
>probe:Drosophila_2:1626882_at:91:721; Interrogation_Position=436; Antisense; TTCCGCCATCGCAGGATCTTATGTG
>probe:Drosophila_2:1626882_at:302:429; Interrogation_Position=510; Antisense; GAGTTCAACGCTCCCAAGGCGCTGG
>probe:Drosophila_2:1626882_at:144:629; Interrogation_Position=576; Antisense; TCCAGGAAATCCGTTGAAGCTTGTC
>probe:Drosophila_2:1626882_at:255:377; Interrogation_Position=591; Antisense; GAAGCTTGTCGGGATACGCATAAAC
>probe:Drosophila_2:1626882_at:165:367; Interrogation_Position=624; Antisense; GAATCTTGCGAGAGGGTCTACCAGA
>probe:Drosophila_2:1626882_at:346:105; Interrogation_Position=646; Antisense; AGACGGCCAAGTGCTTCTCTGAAAA
>probe:Drosophila_2:1626882_at:525:617; Interrogation_Position=657; Antisense; TGCTTCTCTGAAAACGCCGATGGGC
>probe:Drosophila_2:1626882_at:717:303; Interrogation_Position=673; Antisense; CCGATGGGCAGTTCATGTGGCCTTA
>probe:Drosophila_2:1626882_at:511:61; Interrogation_Position=687; Antisense; ATGTGGCCTTAAAAATGTTTCTGGA
>probe:Drosophila_2:1626882_at:303:163; Interrogation_Position=716; Antisense; AAATTCATACTGGTTCATCCTTTAA
>probe:Drosophila_2:1626882_at:207:271; Interrogation_Position=731; Antisense; CATCCTTTAATGACCAATCCTTGGA

Paste this into a BLAST search page for me
ACAGAAGATCTCGATCGGCTTCGCGATCGGCTTCGCGTGGGTGATTTCAATGGGTGATTTCAACTTTCCGCCATCTTCCGCCATCGCAGGATCTTATGTGGAGTTCAACGCTCCCAAGGCGCTGGTCCAGGAAATCCGTTGAAGCTTGTCGAAGCTTGTCGGGATACGCATAAACGAATCTTGCGAGAGGGTCTACCAGAAGACGGCCAAGTGCTTCTCTGAAAATGCTTCTCTGAAAACGCCGATGGGCCCGATGGGCAGTTCATGTGGCCTTAATGTGGCCTTAAAAATGTTTCTGGAAAATTCATACTGGTTCATCCTTTAACATCCTTTAATGACCAATCCTTGGA

Full Affymetrix probeset data:

Annotations for 1626882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720