FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626883_at:

>probe:Drosophila_2:1626883_at:683:197; Interrogation_Position=1943; Antisense; AACGTCGAGGAAGAACCCAGCCTGT
>probe:Drosophila_2:1626883_at:253:177; Interrogation_Position=1977; Antisense; AAACGACATCTCTATCACAATCACC
>probe:Drosophila_2:1626883_at:628:15; Interrogation_Position=2008; Antisense; ATTATCATAACCGAGCGCAGGCGCT
>probe:Drosophila_2:1626883_at:132:71; Interrogation_Position=2026; Antisense; AGGCGCTTTCGATTCGGTTGGGCCA
>probe:Drosophila_2:1626883_at:263:327; Interrogation_Position=2052; Antisense; GCGATGTATTTGCAGGGCGCTTCAT
>probe:Drosophila_2:1626883_at:229:713; Interrogation_Position=2072; Antisense; TTCATTACCATTACCACTCACTATA
>probe:Drosophila_2:1626883_at:277:663; Interrogation_Position=2157; Antisense; TAAATCGACATCTCTCATAACCCGT
>probe:Drosophila_2:1626883_at:97:715; Interrogation_Position=2189; Antisense; TTCTCTATTGTTAAGTGTGCGATTC
>probe:Drosophila_2:1626883_at:354:507; Interrogation_Position=2205; Antisense; GTGCGATTCGTCTATTTGTTACATG
>probe:Drosophila_2:1626883_at:287:61; Interrogation_Position=2227; Antisense; ATGTGCGTGTGGATTCCGGAACCAA
>probe:Drosophila_2:1626883_at:95:305; Interrogation_Position=2242; Antisense; CCGGAACCAAGTACTTATCGCTTAT
>probe:Drosophila_2:1626883_at:292:339; Interrogation_Position=2284; Antisense; GCTCAATCCTTGAGTTTCGTTGAAT
>probe:Drosophila_2:1626883_at:408:43; Interrogation_Position=2460; Antisense; ATCGAAAGCTTTGTAGACTCACAGG
>probe:Drosophila_2:1626883_at:90:405; Interrogation_Position=2475; Antisense; GACTCACAGGTAAGATTCGCTACAA

Paste this into a BLAST search page for me
AACGTCGAGGAAGAACCCAGCCTGTAAACGACATCTCTATCACAATCACCATTATCATAACCGAGCGCAGGCGCTAGGCGCTTTCGATTCGGTTGGGCCAGCGATGTATTTGCAGGGCGCTTCATTTCATTACCATTACCACTCACTATATAAATCGACATCTCTCATAACCCGTTTCTCTATTGTTAAGTGTGCGATTCGTGCGATTCGTCTATTTGTTACATGATGTGCGTGTGGATTCCGGAACCAACCGGAACCAAGTACTTATCGCTTATGCTCAATCCTTGAGTTTCGTTGAATATCGAAAGCTTTGTAGACTCACAGGGACTCACAGGTAAGATTCGCTACAA

Full Affymetrix probeset data:

Annotations for 1626883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720