Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626885_at:

>probe:Drosophila_2:1626885_at:564:123; Interrogation_Position=146; Antisense; AGCCGCTGCTACAGCCAGATCAAGG
>probe:Drosophila_2:1626885_at:30:125; Interrogation_Position=200; Antisense; AGCGCCTCAGGATCTCCAGCTGGAG
>probe:Drosophila_2:1626885_at:528:133; Interrogation_Position=22; Antisense; ACCCAACACGTCCACTTTGTTGATA
>probe:Drosophila_2:1626885_at:349:631; Interrogation_Position=251; Antisense; TCCTCGCCATCGGTTGTGGGACTGA
>probe:Drosophila_2:1626885_at:683:517; Interrogation_Position=266; Antisense; GTGGGACTGACCAGCAATTGCGTGA
>probe:Drosophila_2:1626885_at:213:249; Interrogation_Position=280; Antisense; CAATTGCGTGAAGCCCAGCAGCGGA
>probe:Drosophila_2:1626885_at:550:121; Interrogation_Position=299; Antisense; AGCGGACCCGTTGGACCAGGTGCCT
>probe:Drosophila_2:1626885_at:202:81; Interrogation_Position=342; Antisense; AGGTGCCTGAATACTACAGCTTCAA
>probe:Drosophila_2:1626885_at:35:711; Interrogation_Position=362; Antisense; TTCAATCGCTTTAGCTACGCCGAGG
>probe:Drosophila_2:1626885_at:463:519; Interrogation_Position=392; Antisense; GTGGAAATGGCCAAGTACCGCTGCC
>probe:Drosophila_2:1626885_at:15:321; Interrogation_Position=421; Antisense; GCCCTCGGCCCTCAAGTAGATGTAG
>probe:Drosophila_2:1626885_at:558:99; Interrogation_Position=438; Antisense; AGATGTAGCCCAATTGTTGATGTTA
>probe:Drosophila_2:1626885_at:138:209; Interrogation_Position=85; Antisense; AAGCTAGCCAGCCATTAAGTCCAAC
>probe:Drosophila_2:1626885_at:698:11; Interrogation_Position=98; Antisense; ATTAAGTCCAACATGTTCTCGCCCT

Paste this into a BLAST search page for me
AGCCGCTGCTACAGCCAGATCAAGGAGCGCCTCAGGATCTCCAGCTGGAGACCCAACACGTCCACTTTGTTGATATCCTCGCCATCGGTTGTGGGACTGAGTGGGACTGACCAGCAATTGCGTGACAATTGCGTGAAGCCCAGCAGCGGAAGCGGACCCGTTGGACCAGGTGCCTAGGTGCCTGAATACTACAGCTTCAATTCAATCGCTTTAGCTACGCCGAGGGTGGAAATGGCCAAGTACCGCTGCCGCCCTCGGCCCTCAAGTAGATGTAGAGATGTAGCCCAATTGTTGATGTTAAAGCTAGCCAGCCATTAAGTCCAACATTAAGTCCAACATGTTCTCGCCCT

Full Affymetrix probeset data:

Annotations for 1626885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime