FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626886_at:

>probe:Drosophila_2:1626886_at:403:571; Interrogation_Position=221; Antisense; GGCTTTAGATGTTCCTCTGATTGTA
>probe:Drosophila_2:1626886_at:245:269; Interrogation_Position=300; Antisense; CATGCGAAGCTGGTCTCCGGTAAAA
>probe:Drosophila_2:1626886_at:561:629; Interrogation_Position=315; Antisense; TCCGGTAAAACCCTTTTCAGCATGT
>probe:Drosophila_2:1626886_at:181:713; Interrogation_Position=330; Antisense; TTCAGCATGTTTACTCCCGAAGTCA
>probe:Drosophila_2:1626886_at:559:547; Interrogation_Position=392; Antisense; GGATGTCGTGCTATATGGCCTCGAG
>probe:Drosophila_2:1626886_at:337:151; Interrogation_Position=421; Antisense; ACATTTGCGTGGAGCAGACCGCCAT
>probe:Drosophila_2:1626886_at:281:77; Interrogation_Position=511; Antisense; AGGATCGAGATCTAGCCCTGGATCG
>probe:Drosophila_2:1626886_at:78:293; Interrogation_Position=540; Antisense; CGTCAAGCGGGCTGTGTGATCACCA
>probe:Drosophila_2:1626886_at:266:425; Interrogation_Position=570; Antisense; GAGAGCGTTATCTTCGACTTGGTTC
>probe:Drosophila_2:1626886_at:120:129; Interrogation_Position=609; Antisense; CCCAAGTTCGATGTGGTCCGGAAAT
>probe:Drosophila_2:1626886_at:563:241; Interrogation_Position=631; Antisense; AATTGGTGAACCAGCCGTCGGTGGA
>probe:Drosophila_2:1626886_at:130:589; Interrogation_Position=652; Antisense; TGGATATGGAACTCACGCGCAACGG
>probe:Drosophila_2:1626886_at:316:87; Interrogation_Position=696; Antisense; AGTGCCAAGCTGTGAGATAGCCCCT
>probe:Drosophila_2:1626886_at:164:321; Interrogation_Position=715; Antisense; GCCCCTCCTGTCTAAATATCTGTTT

Paste this into a BLAST search page for me
GGCTTTAGATGTTCCTCTGATTGTACATGCGAAGCTGGTCTCCGGTAAAATCCGGTAAAACCCTTTTCAGCATGTTTCAGCATGTTTACTCCCGAAGTCAGGATGTCGTGCTATATGGCCTCGAGACATTTGCGTGGAGCAGACCGCCATAGGATCGAGATCTAGCCCTGGATCGCGTCAAGCGGGCTGTGTGATCACCAGAGAGCGTTATCTTCGACTTGGTTCCCCAAGTTCGATGTGGTCCGGAAATAATTGGTGAACCAGCCGTCGGTGGATGGATATGGAACTCACGCGCAACGGAGTGCCAAGCTGTGAGATAGCCCCTGCCCCTCCTGTCTAAATATCTGTTT

Full Affymetrix probeset data:

Annotations for 1626886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720