Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626888_at:

>probe:Drosophila_2:1626888_at:167:127; Interrogation_Position=2612; Antisense; AGCCAGCCTCAGATTGTTCCGTAGT
>probe:Drosophila_2:1626888_at:646:717; Interrogation_Position=2628; Antisense; TTCCGTAGTTCGAGTTGTCCTTTAT
>probe:Drosophila_2:1626888_at:620:709; Interrogation_Position=2716; Antisense; TTAACGTATCGTAATTGCTGAACAT
>probe:Drosophila_2:1626888_at:216:481; Interrogation_Position=2759; Antisense; GTTTGTTTTCAAATGTATTCTCTAA
>probe:Drosophila_2:1626888_at:123:701; Interrogation_Position=2785; Antisense; TTTATTGTTGAATTCTGACCAGAGT
>probe:Drosophila_2:1626888_at:584:715; Interrogation_Position=2797; Antisense; TTCTGACCAGAGTGTTAGGAACAAT
>probe:Drosophila_2:1626888_at:508:561; Interrogation_Position=2814; Antisense; GGAACAATGTTTGAGGCGCCCTTGA
>probe:Drosophila_2:1626888_at:593:237; Interrogation_Position=2848; Antisense; AATCTCCACTGAACTTTGTATTAGT
>probe:Drosophila_2:1626888_at:708:481; Interrogation_Position=2871; Antisense; GTATAGTCATTAGGGACGTTTCCTT
>probe:Drosophila_2:1626888_at:404:527; Interrogation_Position=2883; Antisense; GGGACGTTTCCTTATCTGTATGTTA
>probe:Drosophila_2:1626888_at:76:473; Interrogation_Position=2904; Antisense; GTTAATTCGACTAATTCCATTCCGA
>probe:Drosophila_2:1626888_at:307:697; Interrogation_Position=2918; Antisense; TTCCATTCCGACAGTATTCTACTTC
>probe:Drosophila_2:1626888_at:287:401; Interrogation_Position=2927; Antisense; GACAGTATTCTACTTCTAATGCTCG
>probe:Drosophila_2:1626888_at:515:87; Interrogation_Position=3107; Antisense; AGTCCCTAACTGTACCAAAGCAAAT

Paste this into a BLAST search page for me
AGCCAGCCTCAGATTGTTCCGTAGTTTCCGTAGTTCGAGTTGTCCTTTATTTAACGTATCGTAATTGCTGAACATGTTTGTTTTCAAATGTATTCTCTAATTTATTGTTGAATTCTGACCAGAGTTTCTGACCAGAGTGTTAGGAACAATGGAACAATGTTTGAGGCGCCCTTGAAATCTCCACTGAACTTTGTATTAGTGTATAGTCATTAGGGACGTTTCCTTGGGACGTTTCCTTATCTGTATGTTAGTTAATTCGACTAATTCCATTCCGATTCCATTCCGACAGTATTCTACTTCGACAGTATTCTACTTCTAATGCTCGAGTCCCTAACTGTACCAAAGCAAAT

Full Affymetrix probeset data:

Annotations for 1626888_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime