FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626890_at:

>probe:Drosophila_2:1626890_at:323:83; Interrogation_Position=405; Antisense; AGTGGCGCAAGCAGGCACGACTGCA
>probe:Drosophila_2:1626890_at:500:411; Interrogation_Position=440; Antisense; GACGCCTGGCGGATGCGCTGCCTCA
>probe:Drosophila_2:1626890_at:631:1; Interrogation_Position=511; Antisense; ATCCGGCAACGGAGCTACGGCTCGA
>probe:Drosophila_2:1626890_at:28:109; Interrogation_Position=555; Antisense; AGAACCTCTCTTCCGCGAGCAAGGA
>probe:Drosophila_2:1626890_at:198:115; Interrogation_Position=620; Antisense; AGCTTCACCATGATGCACCCGGCAT
>probe:Drosophila_2:1626890_at:81:447; Interrogation_Position=631; Antisense; GATGCACCCGGCATTCCAGCAGCAG
>probe:Drosophila_2:1626890_at:700:267; Interrogation_Position=686; Antisense; CAGGCCACGGATCAGGATAAGCTAT
>probe:Drosophila_2:1626890_at:448:455; Interrogation_Position=701; Antisense; GATAAGCTATCGAAGACCTATACAG
>probe:Drosophila_2:1626890_at:514:663; Interrogation_Position=729; Antisense; TAAAGCTCTATAAGGCGCCGTCGCA
>probe:Drosophila_2:1626890_at:330:383; Interrogation_Position=761; Antisense; GAACTGGGCGGAATGGCCGCCCTAT
>probe:Drosophila_2:1626890_at:574:277; Interrogation_Position=782; Antisense; CTATCCGGACACTCCGACGAGGGTT
>probe:Drosophila_2:1626890_at:287:631; Interrogation_Position=794; Antisense; TCCGACGAGGGTTCCGATGGATCCG
>probe:Drosophila_2:1626890_at:126:295; Interrogation_Position=823; Antisense; CGAGGAGATTGATCTCACCTCCGGC
>probe:Drosophila_2:1626890_at:42:323; Interrogation_Position=846; Antisense; GCGCCTGTATCGATTTCTCCCAGAG

Paste this into a BLAST search page for me
AGTGGCGCAAGCAGGCACGACTGCAGACGCCTGGCGGATGCGCTGCCTCAATCCGGCAACGGAGCTACGGCTCGAAGAACCTCTCTTCCGCGAGCAAGGAAGCTTCACCATGATGCACCCGGCATGATGCACCCGGCATTCCAGCAGCAGCAGGCCACGGATCAGGATAAGCTATGATAAGCTATCGAAGACCTATACAGTAAAGCTCTATAAGGCGCCGTCGCAGAACTGGGCGGAATGGCCGCCCTATCTATCCGGACACTCCGACGAGGGTTTCCGACGAGGGTTCCGATGGATCCGCGAGGAGATTGATCTCACCTCCGGCGCGCCTGTATCGATTTCTCCCAGAG

Full Affymetrix probeset data:

Annotations for 1626890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720