FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626891_at:

>probe:Drosophila_2:1626891_at:67:529; Interrogation_Position=447; Antisense; GGGACCAGCTCCACTGACAGCGGGA
>probe:Drosophila_2:1626891_at:79:529; Interrogation_Position=468; Antisense; GGGAGGAAATCTGCGCATTCCCTTC
>probe:Drosophila_2:1626891_at:412:9; Interrogation_Position=484; Antisense; ATTCCCTTCGGCAAGCAGGCGTTGA
>probe:Drosophila_2:1626891_at:161:421; Interrogation_Position=518; Antisense; GAGAATCCTACGTGGCCAATGGCAG
>probe:Drosophila_2:1626891_at:561:109; Interrogation_Position=551; Antisense; AGCAATATGCCGTCATCGAGATTAT
>probe:Drosophila_2:1626891_at:687:501; Interrogation_Position=612; Antisense; GTCCGGAACGAGTTTCTTCGATCGC
>probe:Drosophila_2:1626891_at:663:275; Interrogation_Position=627; Antisense; CTTCGATCGCTATGGAGCACATGTT
>probe:Drosophila_2:1626891_at:620:727; Interrogation_Position=650; Antisense; TTGGTGCTCCATCCGCCAATGGAAT
>probe:Drosophila_2:1626891_at:655:367; Interrogation_Position=671; Antisense; GAATCCAGCTGGACTCACGGGCTAA
>probe:Drosophila_2:1626891_at:726:137; Interrogation_Position=687; Antisense; ACGGGCTAATTCCTTGCTGCTGGAG
>probe:Drosophila_2:1626891_at:75:481; Interrogation_Position=803; Antisense; GTTTGCCCAACGGTAATGTGTATCT
>probe:Drosophila_2:1626891_at:299:493; Interrogation_Position=815; Antisense; GTAATGTGTATCTCGGCTCCGGATC
>probe:Drosophila_2:1626891_at:453:449; Interrogation_Position=836; Antisense; GATCCCTGGGCTACATCAGTGGTCA
>probe:Drosophila_2:1626891_at:264:589; Interrogation_Position=881; Antisense; TGGAGGCACGCACTCGATCGGAATC

Paste this into a BLAST search page for me
GGGACCAGCTCCACTGACAGCGGGAGGGAGGAAATCTGCGCATTCCCTTCATTCCCTTCGGCAAGCAGGCGTTGAGAGAATCCTACGTGGCCAATGGCAGAGCAATATGCCGTCATCGAGATTATGTCCGGAACGAGTTTCTTCGATCGCCTTCGATCGCTATGGAGCACATGTTTTGGTGCTCCATCCGCCAATGGAATGAATCCAGCTGGACTCACGGGCTAAACGGGCTAATTCCTTGCTGCTGGAGGTTTGCCCAACGGTAATGTGTATCTGTAATGTGTATCTCGGCTCCGGATCGATCCCTGGGCTACATCAGTGGTCATGGAGGCACGCACTCGATCGGAATC

Full Affymetrix probeset data:

Annotations for 1626891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720