Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626893_at:

>probe:Drosophila_2:1626893_at:344:455; Interrogation_Position=1010; Antisense; GATCAATCAACTCAGATACCCCGTT
>probe:Drosophila_2:1626893_at:218:421; Interrogation_Position=1084; Antisense; GATAGAACCTCAAACCGAAATTCGT
>probe:Drosophila_2:1626893_at:633:201; Interrogation_Position=1096; Antisense; AACCGAAATTCGTACCACATCAAGA
>probe:Drosophila_2:1626893_at:440:383; Interrogation_Position=1119; Antisense; GAACTATTTTCCTGCCATTTTCGAA
>probe:Drosophila_2:1626893_at:586:693; Interrogation_Position=1137; Antisense; TTTCGAACTTCTCAGTTGACTCCTG
>probe:Drosophila_2:1626893_at:72:713; Interrogation_Position=1152; Antisense; TTGACTCCTGTACTGTGCTTCTAAT
>probe:Drosophila_2:1626893_at:86:37; Interrogation_Position=1183; Antisense; ATCTATAAATCTCTCTCGTTTCGTC
>probe:Drosophila_2:1626893_at:389:641; Interrogation_Position=1194; Antisense; TCTCTCGTTTCGTCTGAGTCAAACA
>probe:Drosophila_2:1626893_at:250:495; Interrogation_Position=1211; Antisense; GTCAAACATTGCTGTCTCTTCATGT
>probe:Drosophila_2:1626893_at:637:599; Interrogation_Position=1223; Antisense; TGTCTCTTCATGTTTCCGTTTTCAA
>probe:Drosophila_2:1626893_at:311:181; Interrogation_Position=1255; Antisense; AAAACACATCGAAATTGCCACGCAA
>probe:Drosophila_2:1626893_at:386:247; Interrogation_Position=1267; Antisense; AATTGCCACGCAAATTCAGGCTCGA
>probe:Drosophila_2:1626893_at:331:643; Interrogation_Position=1282; Antisense; TCAGGCTCGAAGAACTAACACAAAA
>probe:Drosophila_2:1626893_at:694:649; Interrogation_Position=882; Antisense; TAAGGGCGCGCCAAAAACCAAAGCT

Paste this into a BLAST search page for me
GATCAATCAACTCAGATACCCCGTTGATAGAACCTCAAACCGAAATTCGTAACCGAAATTCGTACCACATCAAGAGAACTATTTTCCTGCCATTTTCGAATTTCGAACTTCTCAGTTGACTCCTGTTGACTCCTGTACTGTGCTTCTAATATCTATAAATCTCTCTCGTTTCGTCTCTCTCGTTTCGTCTGAGTCAAACAGTCAAACATTGCTGTCTCTTCATGTTGTCTCTTCATGTTTCCGTTTTCAAAAAACACATCGAAATTGCCACGCAAAATTGCCACGCAAATTCAGGCTCGATCAGGCTCGAAGAACTAACACAAAATAAGGGCGCGCCAAAAACCAAAGCT

Full Affymetrix probeset data:

Annotations for 1626893_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime