FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626896_at:

>probe:Drosophila_2:1626896_at:228:239; Interrogation_Position=1048; Antisense; AATAAACAGACTTTCGAGCACGATA
>probe:Drosophila_2:1626896_at:544:355; Interrogation_Position=1065; Antisense; GCACGATATAGCTCTACTCTTGTTA
>probe:Drosophila_2:1626896_at:596:145; Interrogation_Position=1080; Antisense; ACTCTTGTTAGATGATCCTGTGACT
>probe:Drosophila_2:1626896_at:672:183; Interrogation_Position=1241; Antisense; AAAAGTGCCGCGATTCATTTGGAAT
>probe:Drosophila_2:1626896_at:441:21; Interrogation_Position=1285; Antisense; ATATGCGCTGGCTTTCAAAACGGTA
>probe:Drosophila_2:1626896_at:411:539; Interrogation_Position=1338; Antisense; GGTTAAGCAGATACATTACTCGGGT
>probe:Drosophila_2:1626896_at:18:247; Interrogation_Position=1386; Antisense; AATTCAGAGCTATGGCGTTTCGGAA
>probe:Drosophila_2:1626896_at:363:185; Interrogation_Position=1426; Antisense; AAAATCGCACACTATATTGACTGGA
>probe:Drosophila_2:1626896_at:542:3; Interrogation_Position=1450; Antisense; ATTGTGGGAGTCGTACGGCCTGACA
>probe:Drosophila_2:1626896_at:366:563; Interrogation_Position=1509; Antisense; GGAAGCGGCAACACCAGCAAATTGT
>probe:Drosophila_2:1626896_at:291:467; Interrogation_Position=1534; Antisense; GTTGTATTGTACTCGCATGCATCCG
>probe:Drosophila_2:1626896_at:418:53; Interrogation_Position=1550; Antisense; ATGCATCCGACAGTCGACAGCTGAG
>probe:Drosophila_2:1626896_at:516:241; Interrogation_Position=1597; Antisense; AATAGCTTCTTCGATTTGCATGGTC
>probe:Drosophila_2:1626896_at:25:295; Interrogation_Position=1608; Antisense; CGATTTGCATGGTCGCTGTTTGAAA

Paste this into a BLAST search page for me
AATAAACAGACTTTCGAGCACGATAGCACGATATAGCTCTACTCTTGTTAACTCTTGTTAGATGATCCTGTGACTAAAAGTGCCGCGATTCATTTGGAATATATGCGCTGGCTTTCAAAACGGTAGGTTAAGCAGATACATTACTCGGGTAATTCAGAGCTATGGCGTTTCGGAAAAAATCGCACACTATATTGACTGGAATTGTGGGAGTCGTACGGCCTGACAGGAAGCGGCAACACCAGCAAATTGTGTTGTATTGTACTCGCATGCATCCGATGCATCCGACAGTCGACAGCTGAGAATAGCTTCTTCGATTTGCATGGTCCGATTTGCATGGTCGCTGTTTGAAA

Full Affymetrix probeset data:

Annotations for 1626896_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720