FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626897_at:

>probe:Drosophila_2:1626897_at:559:491; Interrogation_Position=1050; Antisense; GTAACTCTGGGAGTGACCTCACTGC
>probe:Drosophila_2:1626897_at:414:107; Interrogation_Position=1090; Antisense; AGAATACCCAGTCGCAACAATCGCT
>probe:Drosophila_2:1626897_at:54:283; Interrogation_Position=1113; Antisense; CTGCCGCCGGTTTCGTATGTCAAGG
>probe:Drosophila_2:1626897_at:675:25; Interrogation_Position=1140; Antisense; ATAGACGTCTGGATGTCGTCCTGTT
>probe:Drosophila_2:1626897_at:582:637; Interrogation_Position=1164; Antisense; TCGGTGTTTGTATTCCTTTCTCTGA
>probe:Drosophila_2:1626897_at:665:247; Interrogation_Position=1208; Antisense; CAATTTTATGGGACCGGTGGCCACA
>probe:Drosophila_2:1626897_at:712:383; Interrogation_Position=1259; Antisense; GAACATCAGTGATCTGGACGACCTA
>probe:Drosophila_2:1626897_at:364:555; Interrogation_Position=1274; Antisense; GGACGACCTAAAGTCTGCACTACAG
>probe:Drosophila_2:1626897_at:283:617; Interrogation_Position=1289; Antisense; TGCACTACAGCATCATCGGGAATCG
>probe:Drosophila_2:1626897_at:467:15; Interrogation_Position=1314; Antisense; ATTATTGAGCCCCAGTACGACACTT
>probe:Drosophila_2:1626897_at:53:671; Interrogation_Position=1329; Antisense; TACGACACTTTCTGCCATGGCCATG
>probe:Drosophila_2:1626897_at:692:577; Interrogation_Position=1347; Antisense; GGCCATGCCACAGCCATTTATATAG
>probe:Drosophila_2:1626897_at:341:677; Interrogation_Position=1369; Antisense; TAGACAAATTCTCGCGCTTTTTCTT
>probe:Drosophila_2:1626897_at:671:281; Interrogation_Position=983; Antisense; CTCGGCTCTGATTGTGGTCATGTCT

Paste this into a BLAST search page for me
GTAACTCTGGGAGTGACCTCACTGCAGAATACCCAGTCGCAACAATCGCTCTGCCGCCGGTTTCGTATGTCAAGGATAGACGTCTGGATGTCGTCCTGTTTCGGTGTTTGTATTCCTTTCTCTGACAATTTTATGGGACCGGTGGCCACAGAACATCAGTGATCTGGACGACCTAGGACGACCTAAAGTCTGCACTACAGTGCACTACAGCATCATCGGGAATCGATTATTGAGCCCCAGTACGACACTTTACGACACTTTCTGCCATGGCCATGGGCCATGCCACAGCCATTTATATAGTAGACAAATTCTCGCGCTTTTTCTTCTCGGCTCTGATTGTGGTCATGTCT

Full Affymetrix probeset data:

Annotations for 1626897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720