Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626898_at:

>probe:Drosophila_2:1626898_at:58:459; Interrogation_Position=4349; Antisense; GATATCTTGAATCTGTCGCACGACT
>probe:Drosophila_2:1626898_at:181:501; Interrogation_Position=4363; Antisense; GTCGCACGACTAGGATGGCTGAATC
>probe:Drosophila_2:1626898_at:36:41; Interrogation_Position=4406; Antisense; ATCGAAGTCGCAGTATTTTCCCAAC
>probe:Drosophila_2:1626898_at:581:21; Interrogation_Position=4436; Antisense; ATATTCCCATACGTAATGCCGCGTT
>probe:Drosophila_2:1626898_at:512:49; Interrogation_Position=4451; Antisense; ATGCCGCGTTTGCATCCATTAGCAA
>probe:Drosophila_2:1626898_at:18:217; Interrogation_Position=4480; Antisense; AAGTCGGTCATTTTAATCGCCCAAT
>probe:Drosophila_2:1626898_at:677:297; Interrogation_Position=4497; Antisense; CGCCCAATCAGTAAATCCCGGGATA
>probe:Drosophila_2:1626898_at:149:683; Interrogation_Position=4614; Antisense; TATGCCGTGCATATCTCAATCGAAA
>probe:Drosophila_2:1626898_at:116:47; Interrogation_Position=4647; Antisense; ATCCGTATAGATTTCGCCAGTCCTA
>probe:Drosophila_2:1626898_at:137:505; Interrogation_Position=4666; Antisense; GTCCTACGAGTGAATTTCCGCTTTT
>probe:Drosophila_2:1626898_at:296:701; Interrogation_Position=4687; Antisense; TTTTATTCACCTCACGAGCGCTGTA
>probe:Drosophila_2:1626898_at:514:415; Interrogation_Position=4702; Antisense; GAGCGCTGTATGTCCTTAAACGTAT
>probe:Drosophila_2:1626898_at:657:399; Interrogation_Position=4796; Antisense; GACAGCGCACACATCACTGTGTATT
>probe:Drosophila_2:1626898_at:420:285; Interrogation_Position=4812; Antisense; CTGTGTATTGTATTGCCTACCGTAT

Paste this into a BLAST search page for me
GATATCTTGAATCTGTCGCACGACTGTCGCACGACTAGGATGGCTGAATCATCGAAGTCGCAGTATTTTCCCAACATATTCCCATACGTAATGCCGCGTTATGCCGCGTTTGCATCCATTAGCAAAAGTCGGTCATTTTAATCGCCCAATCGCCCAATCAGTAAATCCCGGGATATATGCCGTGCATATCTCAATCGAAAATCCGTATAGATTTCGCCAGTCCTAGTCCTACGAGTGAATTTCCGCTTTTTTTTATTCACCTCACGAGCGCTGTAGAGCGCTGTATGTCCTTAAACGTATGACAGCGCACACATCACTGTGTATTCTGTGTATTGTATTGCCTACCGTAT

Full Affymetrix probeset data:

Annotations for 1626898_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime