Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626899_at:

>probe:Drosophila_2:1626899_at:135:127; Interrogation_Position=2157; Antisense; ACCACTTCAGAAGCAACTCCGGATG
>probe:Drosophila_2:1626899_at:433:701; Interrogation_Position=2210; Antisense; TTTTAATGCCATACCTGGTGCTCAA
>probe:Drosophila_2:1626899_at:359:647; Interrogation_Position=2244; Antisense; TCATGTTCGAATTGTGGCACCCTCA
>probe:Drosophila_2:1626899_at:70:331; Interrogation_Position=2320; Antisense; GCGGATTGTACTTCAAGCTGCATGG
>probe:Drosophila_2:1626899_at:59:71; Interrogation_Position=2352; Antisense; AGGCCGCATTCAATGAGACGCGATA
>probe:Drosophila_2:1626899_at:632:423; Interrogation_Position=2366; Antisense; GAGACGCGATACCATACACACCAGA
>probe:Drosophila_2:1626899_at:608:357; Interrogation_Position=2471; Antisense; GCAAGATTTCTTGACGGCTAGGGAA
>probe:Drosophila_2:1626899_at:699:677; Interrogation_Position=2489; Antisense; TAGGGAATCTCTAGCCATTTCGGGC
>probe:Drosophila_2:1626899_at:650:161; Interrogation_Position=2539; Antisense; AAATTGATGATACCGAGACCCCAGC
>probe:Drosophila_2:1626899_at:296:125; Interrogation_Position=2561; Antisense; AGCCGCAGCAGCACTTAAAGATATT
>probe:Drosophila_2:1626899_at:195:373; Interrogation_Position=2600; Antisense; GAAGTCAAATTCTTTGCCGGCGTTT
>probe:Drosophila_2:1626899_at:414:317; Interrogation_Position=2615; Antisense; GCCGGCGTTTAATGATACCTGTGAA
>probe:Drosophila_2:1626899_at:234:673; Interrogation_Position=2630; Antisense; TACCTGTGAAAGTGCGGATCTATCC
>probe:Drosophila_2:1626899_at:209:261; Interrogation_Position=2656; Antisense; CACCGCTTAACCTTGTTTCCAGTGA

Paste this into a BLAST search page for me
ACCACTTCAGAAGCAACTCCGGATGTTTTAATGCCATACCTGGTGCTCAATCATGTTCGAATTGTGGCACCCTCAGCGGATTGTACTTCAAGCTGCATGGAGGCCGCATTCAATGAGACGCGATAGAGACGCGATACCATACACACCAGAGCAAGATTTCTTGACGGCTAGGGAATAGGGAATCTCTAGCCATTTCGGGCAAATTGATGATACCGAGACCCCAGCAGCCGCAGCAGCACTTAAAGATATTGAAGTCAAATTCTTTGCCGGCGTTTGCCGGCGTTTAATGATACCTGTGAATACCTGTGAAAGTGCGGATCTATCCCACCGCTTAACCTTGTTTCCAGTGA

Full Affymetrix probeset data:

Annotations for 1626899_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime