FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626901_at:

>probe:Drosophila_2:1626901_at:118:203; Interrogation_Position=2154; Antisense; AACCATGGGTTCGTTCAGGAGGAGA
>probe:Drosophila_2:1626901_at:507:251; Interrogation_Position=2183; Antisense; CAAGGATCGGGATTGTTAGGCTAGA
>probe:Drosophila_2:1626901_at:510:33; Interrogation_Position=2218; Antisense; ATCAAAGTATTATCCCATCCTCATG
>probe:Drosophila_2:1626901_at:149:689; Interrogation_Position=2225; Antisense; TATTATCCCATCCTCATGTACATAC
>probe:Drosophila_2:1626901_at:335:61; Interrogation_Position=2240; Antisense; ATGTACATACTCACATTCCGCTGAG
>probe:Drosophila_2:1626901_at:298:511; Interrogation_Position=2350; Antisense; GTGACATTCTATCCGAGTTTTACAG
>probe:Drosophila_2:1626901_at:572:427; Interrogation_Position=2364; Antisense; GAGTTTTACAGCAACAAAGTCCAAG
>probe:Drosophila_2:1626901_at:641:689; Interrogation_Position=2391; Antisense; TTTGAACCTACATCCTTAAAATCGA
>probe:Drosophila_2:1626901_at:675:1; Interrogation_Position=2453; Antisense; ATTAAAATTCCTGTCTAAGAGCTTT
>probe:Drosophila_2:1626901_at:565:657; Interrogation_Position=2468; Antisense; TAAGAGCTTTAGACTCGCCTAGATT
>probe:Drosophila_2:1626901_at:387:405; Interrogation_Position=2479; Antisense; GACTCGCCTAGATTTTCCGTTTTAT
>probe:Drosophila_2:1626901_at:172:715; Interrogation_Position=2503; Antisense; TTCTCGAACCTTAACCTGTTTCCAT
>probe:Drosophila_2:1626901_at:202:305; Interrogation_Position=2517; Antisense; CCTGTTTCCATTACTATTCACCTAA
>probe:Drosophila_2:1626901_at:353:43; Interrogation_Position=2623; Antisense; ATCGTATCTTACTGCGATATGTTAT

Paste this into a BLAST search page for me
AACCATGGGTTCGTTCAGGAGGAGACAAGGATCGGGATTGTTAGGCTAGAATCAAAGTATTATCCCATCCTCATGTATTATCCCATCCTCATGTACATACATGTACATACTCACATTCCGCTGAGGTGACATTCTATCCGAGTTTTACAGGAGTTTTACAGCAACAAAGTCCAAGTTTGAACCTACATCCTTAAAATCGAATTAAAATTCCTGTCTAAGAGCTTTTAAGAGCTTTAGACTCGCCTAGATTGACTCGCCTAGATTTTCCGTTTTATTTCTCGAACCTTAACCTGTTTCCATCCTGTTTCCATTACTATTCACCTAAATCGTATCTTACTGCGATATGTTAT

Full Affymetrix probeset data:

Annotations for 1626901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720