FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626903_at:

>probe:Drosophila_2:1626903_at:487:407; Interrogation_Position=1021; Antisense; GACGGCTGCTACTGCCAGAGTTAGA
>probe:Drosophila_2:1626903_at:479:181; Interrogation_Position=1059; Antisense; AAAAAACTCATTTCCTTGCCTCATT
>probe:Drosophila_2:1626903_at:351:103; Interrogation_Position=548; Antisense; AGACCACTGTGCATCCTAACTACGA
>probe:Drosophila_2:1626903_at:563:5; Interrogation_Position=583; Antisense; ATTGTCAACGATGTGGCGCTGCTCA
>probe:Drosophila_2:1626903_at:124:559; Interrogation_Position=634; Antisense; GGAAACATGCGTCCAGTCTGTCTGC
>probe:Drosophila_2:1626903_at:552:625; Interrogation_Position=656; Antisense; TGCCCGAGGCCAATCATAACTTTGA
>probe:Drosophila_2:1626903_at:621:275; Interrogation_Position=675; Antisense; CTTTGATGGCAAGACCGCTGTGGTT
>probe:Drosophila_2:1626903_at:387:75; Interrogation_Position=749; Antisense; AGGAGGTCAATGTGCCCGTCATCAC
>probe:Drosophila_2:1626903_at:535:95; Interrogation_Position=809; Antisense; AGATTGCCGAGGTGATGCTCTGCGC
>probe:Drosophila_2:1626903_at:30:593; Interrogation_Position=879; Antisense; TGGTGGCCCACTGATCGTCAACGAG
>probe:Drosophila_2:1626903_at:99:199; Interrogation_Position=898; Antisense; AACGAGGGTCGCTACAAGCTGGCCG
>probe:Drosophila_2:1626903_at:595:305; Interrogation_Position=932; Antisense; CCTTCGGCTACGGATGTGCACAGAA
>probe:Drosophila_2:1626903_at:270:515; Interrogation_Position=968; Antisense; GTGTCTACGCCAGGGTGAGCAAGTT
>probe:Drosophila_2:1626903_at:78:139; Interrogation_Position=998; Antisense; ACTGGATCCGTAAGAACACCGCCGA

Paste this into a BLAST search page for me
GACGGCTGCTACTGCCAGAGTTAGAAAAAAACTCATTTCCTTGCCTCATTAGACCACTGTGCATCCTAACTACGAATTGTCAACGATGTGGCGCTGCTCAGGAAACATGCGTCCAGTCTGTCTGCTGCCCGAGGCCAATCATAACTTTGACTTTGATGGCAAGACCGCTGTGGTTAGGAGGTCAATGTGCCCGTCATCACAGATTGCCGAGGTGATGCTCTGCGCTGGTGGCCCACTGATCGTCAACGAGAACGAGGGTCGCTACAAGCTGGCCGCCTTCGGCTACGGATGTGCACAGAAGTGTCTACGCCAGGGTGAGCAAGTTACTGGATCCGTAAGAACACCGCCGA

Full Affymetrix probeset data:

Annotations for 1626903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720