FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626904_at:

>probe:Drosophila_2:1626904_at:31:493; Interrogation_Position=1354; Antisense; GTAATGCTGGCCTTCTTTGACACTT
>probe:Drosophila_2:1626904_at:562:693; Interrogation_Position=1369; Antisense; TTTGACACTTTGGTGCAGCACGAGC
>probe:Drosophila_2:1626904_at:165:113; Interrogation_Position=1385; Antisense; AGCACGAGCTTGAGTCCTGGAGCAC
>probe:Drosophila_2:1626904_at:198:269; Interrogation_Position=1448; Antisense; CATCTACGTGTAGCGAGGCCAGTTC
>probe:Drosophila_2:1626904_at:444:35; Interrogation_Position=1502; Antisense; ATCAGGACCCTCAGACTGACCGGAA
>probe:Drosophila_2:1626904_at:160:457; Interrogation_Position=1561; Antisense; GATACGCCTAACGTCAGCGAACTGA
>probe:Drosophila_2:1626904_at:468:607; Interrogation_Position=1583; Antisense; TGAGCTGGCAGACTTATCCGAACCG
>probe:Drosophila_2:1626904_at:624:303; Interrogation_Position=1605; Antisense; CCGTATCTTCTACCTAATCGCTAAA
>probe:Drosophila_2:1626904_at:174:277; Interrogation_Position=1637; Antisense; GCTCCTTACTTCAGTTAGCGGTTAG
>probe:Drosophila_2:1626904_at:176:95; Interrogation_Position=1694; Antisense; AGTTGCTCCAGAGGCTCATTGGCGA
>probe:Drosophila_2:1626904_at:178:71; Interrogation_Position=1739; Antisense; AGGCGCGCATCAGCGACTGGCTTGA
>probe:Drosophila_2:1626904_at:347:103; Interrogation_Position=1766; Antisense; AGACGCAGCGTCTCTTTGGCGACGA
>probe:Drosophila_2:1626904_at:435:573; Interrogation_Position=1846; Antisense; GGCGTTCTGCTCTGTCGAAATCGGA
>probe:Drosophila_2:1626904_at:352:531; Interrogation_Position=1896; Antisense; GGCCGGTGGCGGTACACTATACGTA

Paste this into a BLAST search page for me
GTAATGCTGGCCTTCTTTGACACTTTTTGACACTTTGGTGCAGCACGAGCAGCACGAGCTTGAGTCCTGGAGCACCATCTACGTGTAGCGAGGCCAGTTCATCAGGACCCTCAGACTGACCGGAAGATACGCCTAACGTCAGCGAACTGATGAGCTGGCAGACTTATCCGAACCGCCGTATCTTCTACCTAATCGCTAAAGCTCCTTACTTCAGTTAGCGGTTAGAGTTGCTCCAGAGGCTCATTGGCGAAGGCGCGCATCAGCGACTGGCTTGAAGACGCAGCGTCTCTTTGGCGACGAGGCGTTCTGCTCTGTCGAAATCGGAGGCCGGTGGCGGTACACTATACGTA

Full Affymetrix probeset data:

Annotations for 1626904_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720