FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626905_at:

>probe:Drosophila_2:1626905_at:359:487; Interrogation_Position=1006; Antisense; GTACTCTATGAGCTAGCATTGCATC
>probe:Drosophila_2:1626905_at:266:219; Interrogation_Position=1111; Antisense; AAGTCGCTTAGTTTCATGGGTCAGG
>probe:Drosophila_2:1626905_at:426:295; Interrogation_Position=1143; Antisense; CGAAACACTACGAATGCATCCCATA
>probe:Drosophila_2:1626905_at:40:3; Interrogation_Position=1177; Antisense; ATCCTACGTCGCACCTTAAATGACT
>probe:Drosophila_2:1626905_at:391:231; Interrogation_Position=1195; Antisense; AATGACTACGCAGTTCCGGATCATC
>probe:Drosophila_2:1626905_at:96:537; Interrogation_Position=1233; Antisense; GGTCAAGGAGCTGTTCCTCATCATA
>probe:Drosophila_2:1626905_at:163:459; Interrogation_Position=1285; Antisense; GATATCTATCCGGATCCCGAGGAAT
>probe:Drosophila_2:1626905_at:722:39; Interrogation_Position=1319; Antisense; ATCGTTGGAGCGGACCACGGGATTC
>probe:Drosophila_2:1626905_at:572:531; Interrogation_Position=1380; Antisense; GGGTGCTCGCAGTTGCATTGGTATA
>probe:Drosophila_2:1626905_at:563:729; Interrogation_Position=1397; Antisense; TTGGTATACAATTCGCACAGCTGCA
>probe:Drosophila_2:1626905_at:119:155; Interrogation_Position=1413; Antisense; ACAGCTGCAACTGCGATTGGCATTG
>probe:Drosophila_2:1626905_at:128:573; Interrogation_Position=1437; Antisense; GGCTCTGCTTCTATCCGAGTATGAA
>probe:Drosophila_2:1626905_at:74:27; Interrogation_Position=1507; Antisense; ATAGCACTAACCCTGATGCCATTGG
>probe:Drosophila_2:1626905_at:23:257; Interrogation_Position=982; Antisense; CAAACGGCCAACACTCTATCATATG

Paste this into a BLAST search page for me
GTACTCTATGAGCTAGCATTGCATCAAGTCGCTTAGTTTCATGGGTCAGGCGAAACACTACGAATGCATCCCATAATCCTACGTCGCACCTTAAATGACTAATGACTACGCAGTTCCGGATCATCGGTCAAGGAGCTGTTCCTCATCATAGATATCTATCCGGATCCCGAGGAATATCGTTGGAGCGGACCACGGGATTCGGGTGCTCGCAGTTGCATTGGTATATTGGTATACAATTCGCACAGCTGCAACAGCTGCAACTGCGATTGGCATTGGGCTCTGCTTCTATCCGAGTATGAAATAGCACTAACCCTGATGCCATTGGCAAACGGCCAACACTCTATCATATG

Full Affymetrix probeset data:

Annotations for 1626905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720