FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626906_at:

>probe:Drosophila_2:1626906_at:246:363; Interrogation_Position=225; Antisense; GAATTTGCAGTTCCGAAACCTCTTG
>probe:Drosophila_2:1626906_at:485:391; Interrogation_Position=239; Antisense; GAAACCTCTTGGTGGAGCCGAACAA
>probe:Drosophila_2:1626906_at:156:39; Interrogation_Position=265; Antisense; ATCTACAAGTGGACAGGCCTGCTGA
>probe:Drosophila_2:1626906_at:278:533; Interrogation_Position=294; Antisense; GGTGGCACCGCCTTATGACAAGGGT
>probe:Drosophila_2:1626906_at:161:551; Interrogation_Position=330; Antisense; GGAGATCGACTTTCCACTGGACTAC
>probe:Drosophila_2:1626906_at:729:545; Interrogation_Position=389; Antisense; GGATGTACCACCTGAATGTCAATGA
>probe:Drosophila_2:1626906_at:251:589; Interrogation_Position=440; Antisense; TGGAGGTCGAGCACTGGATCCCAAC
>probe:Drosophila_2:1626906_at:310:203; Interrogation_Position=462; Antisense; AACCACGCGGATTGACCAGGTGCTG
>probe:Drosophila_2:1626906_at:287:129; Interrogation_Position=502; Antisense; ACCATCAATGATCCACAGCCGGAGA
>probe:Drosophila_2:1626906_at:437:355; Interrogation_Position=534; Antisense; GCACATCGAAATGGCCGGCGAGTAT
>probe:Drosophila_2:1626906_at:658:361; Interrogation_Position=560; Antisense; GCAATGATCCGGTGCGATTCTTCAA
>probe:Drosophila_2:1626906_at:653:507; Interrogation_Position=571; Antisense; GTGCGATTCTTCAAAATGGCCGATG
>probe:Drosophila_2:1626906_at:504:615; Interrogation_Position=602; Antisense; TGCAGAAGTACAGTGAACCCCGGCC
>probe:Drosophila_2:1626906_at:224:67; Interrogation_Position=622; Antisense; CGGCCCACTGAAGAGGAGCTAGCAA

Paste this into a BLAST search page for me
GAATTTGCAGTTCCGAAACCTCTTGGAAACCTCTTGGTGGAGCCGAACAAATCTACAAGTGGACAGGCCTGCTGAGGTGGCACCGCCTTATGACAAGGGTGGAGATCGACTTTCCACTGGACTACGGATGTACCACCTGAATGTCAATGATGGAGGTCGAGCACTGGATCCCAACAACCACGCGGATTGACCAGGTGCTGACCATCAATGATCCACAGCCGGAGAGCACATCGAAATGGCCGGCGAGTATGCAATGATCCGGTGCGATTCTTCAAGTGCGATTCTTCAAAATGGCCGATGTGCAGAAGTACAGTGAACCCCGGCCCGGCCCACTGAAGAGGAGCTAGCAA

Full Affymetrix probeset data:

Annotations for 1626906_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720