FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626908_at:

>probe:Drosophila_2:1626908_at:336:161; Interrogation_Position=1043; Antisense; ACAATGTTAATGCTCCTGACCTGGG
>probe:Drosophila_2:1626908_at:493:51; Interrogation_Position=1052; Antisense; ATGCTCCTGACCTGGGCAAACAATT
>probe:Drosophila_2:1626908_at:294:59; Interrogation_Position=1080; Antisense; ATGATATCACAAAACGACAGGCCTG
>probe:Drosophila_2:1626908_at:695:727; Interrogation_Position=563; Antisense; TTGGGTTTCAGGTACAAGCCGGTGA
>probe:Drosophila_2:1626908_at:687:187; Interrogation_Position=600; Antisense; AACTGTTCCGATGTTGGTTAACCAG
>probe:Drosophila_2:1626908_at:688:657; Interrogation_Position=618; Antisense; TAACCAGTTCTGTTGGCATAACCAG
>probe:Drosophila_2:1626908_at:239:567; Interrogation_Position=632; Antisense; GGCATAACCAGTTTGTTTATATCTC
>probe:Drosophila_2:1626908_at:506:237; Interrogation_Position=679; Antisense; AATCGTATTATCTTTTCTCTCAACT
>probe:Drosophila_2:1626908_at:24:459; Interrogation_Position=713; Antisense; GTTTAATTAGTCAGCGTGGGCGTCA
>probe:Drosophila_2:1626908_at:273:35; Interrogation_Position=737; Antisense; ATCAGCGGTGTCAGTGGATGTTACA
>probe:Drosophila_2:1626908_at:626:179; Interrogation_Position=856; Antisense; AAACACAACTGGCAACTGGTAACTA
>probe:Drosophila_2:1626908_at:693:689; Interrogation_Position=920; Antisense; TATTCATTCTTATCAACCTTCATTG
>probe:Drosophila_2:1626908_at:270:365; Interrogation_Position=944; Antisense; GAATAATCATTATCTCTCGAAAAGT
>probe:Drosophila_2:1626908_at:254:179; Interrogation_Position=984; Antisense; AAACATTTGCTAACGACTGACTCAA

Paste this into a BLAST search page for me
ACAATGTTAATGCTCCTGACCTGGGATGCTCCTGACCTGGGCAAACAATTATGATATCACAAAACGACAGGCCTGTTGGGTTTCAGGTACAAGCCGGTGAAACTGTTCCGATGTTGGTTAACCAGTAACCAGTTCTGTTGGCATAACCAGGGCATAACCAGTTTGTTTATATCTCAATCGTATTATCTTTTCTCTCAACTGTTTAATTAGTCAGCGTGGGCGTCAATCAGCGGTGTCAGTGGATGTTACAAAACACAACTGGCAACTGGTAACTATATTCATTCTTATCAACCTTCATTGGAATAATCATTATCTCTCGAAAAGTAAACATTTGCTAACGACTGACTCAA

Full Affymetrix probeset data:

Annotations for 1626908_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720