FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626909_at:

>probe:Drosophila_2:1626909_at:340:579; Interrogation_Position=474; Antisense; GGCCTCCACTAGCTTTGACGAAACA
>probe:Drosophila_2:1626909_at:668:607; Interrogation_Position=489; Antisense; TGACGAAACAGTGCGCCTTTGGGAT
>probe:Drosophila_2:1626909_at:164:721; Interrogation_Position=507; Antisense; TTGGGATGTCCGCACTGGCAAAACG
>probe:Drosophila_2:1626909_at:354:363; Interrogation_Position=590; Antisense; GCAATATTTTTGTCACCAGCAGCTA
>probe:Drosophila_2:1626909_at:220:525; Interrogation_Position=649; Antisense; GGGCATGTGCTGAAGACTCTCGTTG
>probe:Drosophila_2:1626909_at:489:611; Interrogation_Position=672; Antisense; TGACGTTGACAACATCCCGGTCGGA
>probe:Drosophila_2:1626909_at:587:257; Interrogation_Position=738; Antisense; CACATTGAACAACACCCTTAGGCTA
>probe:Drosophila_2:1626909_at:528:379; Interrogation_Position=774; Antisense; GAAGCCCAAGTGCATGAGGACCTAT
>probe:Drosophila_2:1626909_at:710:57; Interrogation_Position=787; Antisense; ATGAGGACCTATCGCGGGCATTTGA
>probe:Drosophila_2:1626909_at:403:91; Interrogation_Position=815; Antisense; AGTTCTATTGCTCCAACTCCAATTT
>probe:Drosophila_2:1626909_at:700:345; Interrogation_Position=854; Antisense; GCATTTGGATTGTCTCCGGCAGCGA
>probe:Drosophila_2:1626909_at:273:523; Interrogation_Position=942; Antisense; GGGCGACCAGATTTTGAGCACACAT
>probe:Drosophila_2:1626909_at:226:169; Interrogation_Position=981; Antisense; AAATGTGATTGCTAGCGGCGCCCTA
>probe:Drosophila_2:1626909_at:69:121; Interrogation_Position=994; Antisense; AGCGGCGCCCTACAAAATTCATATG

Paste this into a BLAST search page for me
GGCCTCCACTAGCTTTGACGAAACATGACGAAACAGTGCGCCTTTGGGATTTGGGATGTCCGCACTGGCAAAACGGCAATATTTTTGTCACCAGCAGCTAGGGCATGTGCTGAAGACTCTCGTTGTGACGTTGACAACATCCCGGTCGGACACATTGAACAACACCCTTAGGCTAGAAGCCCAAGTGCATGAGGACCTATATGAGGACCTATCGCGGGCATTTGAAGTTCTATTGCTCCAACTCCAATTTGCATTTGGATTGTCTCCGGCAGCGAGGGCGACCAGATTTTGAGCACACATAAATGTGATTGCTAGCGGCGCCCTAAGCGGCGCCCTACAAAATTCATATG

Full Affymetrix probeset data:

Annotations for 1626909_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720