FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626910_at:

>probe:Drosophila_2:1626910_at:576:299; Interrogation_Position=137; Antisense; CGCGCTTCCTCAATTCGGATATGGA
>probe:Drosophila_2:1626910_at:58:353; Interrogation_Position=200; Antisense; GCAGCAAGAAGGATTCGGCGGTTTC
>probe:Drosophila_2:1626910_at:212:433; Interrogation_Position=21; Antisense; GAGTGCAACATCGAAGCATCCTCAT
>probe:Drosophila_2:1626910_at:236:263; Interrogation_Position=249; Antisense; CAGCAGGAAAGCTTCGGTGGATTCG
>probe:Drosophila_2:1626910_at:178:459; Interrogation_Position=277; Antisense; GATTTGGAGGAATCGAGCAGCAGCA
>probe:Drosophila_2:1626910_at:203:75; Interrogation_Position=314; Antisense; AGGAGGCTTCTTCTAAGGCTGTTAC
>probe:Drosophila_2:1626910_at:24:65; Interrogation_Position=329; Antisense; AGGCTGTTACTTTAGTTCCTCGACT
>probe:Drosophila_2:1626910_at:431:377; Interrogation_Position=33; Antisense; GAAGCATCCTCATCTTCTGGGATAT
>probe:Drosophila_2:1626910_at:577:29; Interrogation_Position=418; Antisense; ATACTCATTTACATGTTTTGACAAT
>probe:Drosophila_2:1626910_at:598:395; Interrogation_Position=437; Antisense; GACAATGGCTTATTGTAGGCCTTTA
>probe:Drosophila_2:1626910_at:487:485; Interrogation_Position=451; Antisense; GTAGGCCTTTAGATCGACAGAGATT
>probe:Drosophila_2:1626910_at:104:493; Interrogation_Position=486; Antisense; GTAACCTTCATTTATTTCGCTTGCT
>probe:Drosophila_2:1626910_at:397:715; Interrogation_Position=501; Antisense; TTCGCTTGCTTATAAATACGTTTGG
>probe:Drosophila_2:1626910_at:705:645; Interrogation_Position=97; Antisense; TCTTGGTGATCGTTTTTGTGGCCCT

Paste this into a BLAST search page for me
CGCGCTTCCTCAATTCGGATATGGAGCAGCAAGAAGGATTCGGCGGTTTCGAGTGCAACATCGAAGCATCCTCATCAGCAGGAAAGCTTCGGTGGATTCGGATTTGGAGGAATCGAGCAGCAGCAAGGAGGCTTCTTCTAAGGCTGTTACAGGCTGTTACTTTAGTTCCTCGACTGAAGCATCCTCATCTTCTGGGATATATACTCATTTACATGTTTTGACAATGACAATGGCTTATTGTAGGCCTTTAGTAGGCCTTTAGATCGACAGAGATTGTAACCTTCATTTATTTCGCTTGCTTTCGCTTGCTTATAAATACGTTTGGTCTTGGTGATCGTTTTTGTGGCCCT

Full Affymetrix probeset data:

Annotations for 1626910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720