Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626911_at:

>probe:Drosophila_2:1626911_at:397:437; Interrogation_Position=2004; Antisense; GAGGAAACGTACACGGAGGCACCAA
>probe:Drosophila_2:1626911_at:556:223; Interrogation_Position=2073; Antisense; AAGGATCCCATTGAACTTGCCCTGG
>probe:Drosophila_2:1626911_at:288:465; Interrogation_Position=2108; Antisense; GTTGCAACCGGAGGGATCCCTTCCA
>probe:Drosophila_2:1626911_at:633:299; Interrogation_Position=2154; Antisense; CCCGTCCACGAGCAGTACAAGATGA
>probe:Drosophila_2:1626911_at:278:443; Interrogation_Position=2174; Antisense; GATGATCCATGACAACCTGGCGATG
>probe:Drosophila_2:1626911_at:75:583; Interrogation_Position=2191; Antisense; TGGCGATGGAGTTCCGCGATCACGA
>probe:Drosophila_2:1626911_at:528:451; Interrogation_Position=2208; Antisense; GATCACGACGGTCACTCGGAGCGAC
>probe:Drosophila_2:1626911_at:152:581; Interrogation_Position=2284; Antisense; TGGCCATTCTTATCGGGTGCAGGAT
>probe:Drosophila_2:1626911_at:445:565; Interrogation_Position=2343; Antisense; GGCAAGACGCCCTACTCACAGGAGG
>probe:Drosophila_2:1626911_at:248:151; Interrogation_Position=2360; Antisense; ACAGGAGGCGGACTTCCTGGTCAAC
>probe:Drosophila_2:1626911_at:657:305; Interrogation_Position=2375; Antisense; CCTGGTCAACGGCATGTATCTGTAA
>probe:Drosophila_2:1626911_at:422:57; Interrogation_Position=2388; Antisense; ATGTATCTGTAAGCCGGTTGCCTGC
>probe:Drosophila_2:1626911_at:380:203; Interrogation_Position=2398; Antisense; AAGCCGGTTGCCTGCGGATTAGGTC
>probe:Drosophila_2:1626911_at:435:95; Interrogation_Position=2435; Antisense; AGATTCGTTGTGTTGTTCCACGTGC

Paste this into a BLAST search page for me
GAGGAAACGTACACGGAGGCACCAAAAGGATCCCATTGAACTTGCCCTGGGTTGCAACCGGAGGGATCCCTTCCACCCGTCCACGAGCAGTACAAGATGAGATGATCCATGACAACCTGGCGATGTGGCGATGGAGTTCCGCGATCACGAGATCACGACGGTCACTCGGAGCGACTGGCCATTCTTATCGGGTGCAGGATGGCAAGACGCCCTACTCACAGGAGGACAGGAGGCGGACTTCCTGGTCAACCCTGGTCAACGGCATGTATCTGTAAATGTATCTGTAAGCCGGTTGCCTGCAAGCCGGTTGCCTGCGGATTAGGTCAGATTCGTTGTGTTGTTCCACGTGC

Full Affymetrix probeset data:

Annotations for 1626911_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime