FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626912_at:

>probe:Drosophila_2:1626912_at:513:597; Interrogation_Position=1014; Antisense; TGTCTTTATCATTTACGTTTCCGTA
>probe:Drosophila_2:1626912_at:174:127; Interrogation_Position=1048; Antisense; AGCCTGATTCTGTTTACCTGTGAGC
>probe:Drosophila_2:1626912_at:179:117; Interrogation_Position=552; Antisense; AGCTTTGATGGAATCGCCTGTGCGC
>probe:Drosophila_2:1626912_at:169:317; Interrogation_Position=567; Antisense; GCCTGTGCGCATCATCTCTATAAGA
>probe:Drosophila_2:1626912_at:375:657; Interrogation_Position=587; Antisense; TAAGATCTGAATACTCGGCCATTGA
>probe:Drosophila_2:1626912_at:207:289; Interrogation_Position=602; Antisense; CGGCCATTGAATTTACGCAGCGCAC
>probe:Drosophila_2:1626912_at:514:163; Interrogation_Position=628; Antisense; AAATACTCGGCTGCATTCCATTTGG
>probe:Drosophila_2:1626912_at:474:665; Interrogation_Position=696; Antisense; TACATCCTACGGCTATACTATCACT
>probe:Drosophila_2:1626912_at:346:175; Interrogation_Position=765; Antisense; AAAGCCAGTGTTTCGGTATTCCAAG
>probe:Drosophila_2:1626912_at:568:307; Interrogation_Position=814; Antisense; CCATTTGGACTGGTCATTCCGGAGA
>probe:Drosophila_2:1626912_at:509:9; Interrogation_Position=829; Antisense; ATTCCGGAGAACTCGCCTCATAGAG
>probe:Drosophila_2:1626912_at:108:103; Interrogation_Position=850; Antisense; AGAGCTCCATTGCATAGTTACACCC
>probe:Drosophila_2:1626912_at:571:333; Interrogation_Position=889; Antisense; GCTGGTCTGCATGATTTCTGGGTGA
>probe:Drosophila_2:1626912_at:151:657; Interrogation_Position=945; Antisense; TAAGATCAACTTTACAGCCGTCGGG

Paste this into a BLAST search page for me
TGTCTTTATCATTTACGTTTCCGTAAGCCTGATTCTGTTTACCTGTGAGCAGCTTTGATGGAATCGCCTGTGCGCGCCTGTGCGCATCATCTCTATAAGATAAGATCTGAATACTCGGCCATTGACGGCCATTGAATTTACGCAGCGCACAAATACTCGGCTGCATTCCATTTGGTACATCCTACGGCTATACTATCACTAAAGCCAGTGTTTCGGTATTCCAAGCCATTTGGACTGGTCATTCCGGAGAATTCCGGAGAACTCGCCTCATAGAGAGAGCTCCATTGCATAGTTACACCCGCTGGTCTGCATGATTTCTGGGTGATAAGATCAACTTTACAGCCGTCGGG

Full Affymetrix probeset data:

Annotations for 1626912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720