FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626916_at:

>probe:Drosophila_2:1626916_at:49:101; Interrogation_Position=115; Antisense; AGAGATATGCATTTACACAGGGAAA
>probe:Drosophila_2:1626916_at:585:217; Interrogation_Position=157; Antisense; AAGTTTCTGCGCGTCGTGACCAGAG
>probe:Drosophila_2:1626916_at:296:329; Interrogation_Position=167; Antisense; GCGTCGTGACCAGAGAATTTGTGTT
>probe:Drosophila_2:1626916_at:187:585; Interrogation_Position=207; Antisense; TGGCACGCACCATCACTCAAATTGT
>probe:Drosophila_2:1626916_at:1:169; Interrogation_Position=256; Antisense; AAATGGTGGCTATGCGTATCTAACT
>probe:Drosophila_2:1626916_at:639:239; Interrogation_Position=27; Antisense; AATACTACTAGTATTCGCGCTGACC
>probe:Drosophila_2:1626916_at:99:293; Interrogation_Position=270; Antisense; CGTATCTAACTGCTGGTGGACCACA
>probe:Drosophila_2:1626916_at:401:555; Interrogation_Position=287; Antisense; GGACCACAGACCACATATGCCAAGA
>probe:Drosophila_2:1626916_at:669:413; Interrogation_Position=295; Antisense; GACCACATATGCCAAGATCCACTTG
>probe:Drosophila_2:1626916_at:451:431; Interrogation_Position=322; Antisense; GAGTCAACGGAATCAGGGCTTCAGT
>probe:Drosophila_2:1626916_at:364:83; Interrogation_Position=336; Antisense; AGGGCTTCAGTTTCATCATCGACAT
>probe:Drosophila_2:1626916_at:184:37; Interrogation_Position=350; Antisense; ATCATCGACATATACGGCGTTTAAT
>probe:Drosophila_2:1626916_at:414:575; Interrogation_Position=71; Antisense; GGCGTGGCCGTAGTCACAGTATTAC
>probe:Drosophila_2:1626916_at:572:523; Interrogation_Position=99; Antisense; GGGCGCCAGAACCTATAGAGATATG

Paste this into a BLAST search page for me
AGAGATATGCATTTACACAGGGAAAAAGTTTCTGCGCGTCGTGACCAGAGGCGTCGTGACCAGAGAATTTGTGTTTGGCACGCACCATCACTCAAATTGTAAATGGTGGCTATGCGTATCTAACTAATACTACTAGTATTCGCGCTGACCCGTATCTAACTGCTGGTGGACCACAGGACCACAGACCACATATGCCAAGAGACCACATATGCCAAGATCCACTTGGAGTCAACGGAATCAGGGCTTCAGTAGGGCTTCAGTTTCATCATCGACATATCATCGACATATACGGCGTTTAATGGCGTGGCCGTAGTCACAGTATTACGGGCGCCAGAACCTATAGAGATATG

Full Affymetrix probeset data:

Annotations for 1626916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720