Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626917_at:

>probe:Drosophila_2:1626917_at:566:371; Interrogation_Position=305; Antisense; GAAGGACGCTGTGTGCACTTCAGCT
>probe:Drosophila_2:1626917_at:718:497; Interrogation_Position=341; Antisense; GTCTTGCGTCACTATGCGATGTACA
>probe:Drosophila_2:1626917_at:530:655; Interrogation_Position=387; Antisense; TAATGCGATTCCTGCAGAGGGTCCG
>probe:Drosophila_2:1626917_at:562:265; Interrogation_Position=401; Antisense; CAGAGGGTCCGTTGCAAGCCGAAAC
>probe:Drosophila_2:1626917_at:215:371; Interrogation_Position=428; Antisense; GAAGGCTATCATTTGTGCTGCGAAC
>probe:Drosophila_2:1626917_at:680:171; Interrogation_Position=455; Antisense; AAAGATGTGATTCCCGCGAACGCCA
>probe:Drosophila_2:1626917_at:726:711; Interrogation_Position=503; Antisense; TTCAAAGTGCCTCATGTGCGTGCGA
>probe:Drosophila_2:1626917_at:211:85; Interrogation_Position=531; Antisense; AGTGTGCGGACTTTGATCTGCTAAA
>probe:Drosophila_2:1626917_at:390:583; Interrogation_Position=561; Antisense; TGGTAGCTTTTTGTTTGGGCCCATA
>probe:Drosophila_2:1626917_at:509:201; Interrogation_Position=585; Antisense; AACCGAAATGTTATGGCCGCGTGCG
>probe:Drosophila_2:1626917_at:77:705; Interrogation_Position=641; Antisense; TTATGTATTAAGTGCGCCTTTCGCC
>probe:Drosophila_2:1626917_at:517:629; Interrogation_Position=734; Antisense; TCCTGCTCGAGTTGGTTCTTGTGTA
>probe:Drosophila_2:1626917_at:475:17; Interrogation_Position=776; Antisense; ATTTGAACTTGCAACACCTACTGCC
>probe:Drosophila_2:1626917_at:64:293; Interrogation_Position=804; Antisense; CGTCTGTCAGTAGTCGGGCATCGAA

Paste this into a BLAST search page for me
GAAGGACGCTGTGTGCACTTCAGCTGTCTTGCGTCACTATGCGATGTACATAATGCGATTCCTGCAGAGGGTCCGCAGAGGGTCCGTTGCAAGCCGAAACGAAGGCTATCATTTGTGCTGCGAACAAAGATGTGATTCCCGCGAACGCCATTCAAAGTGCCTCATGTGCGTGCGAAGTGTGCGGACTTTGATCTGCTAAATGGTAGCTTTTTGTTTGGGCCCATAAACCGAAATGTTATGGCCGCGTGCGTTATGTATTAAGTGCGCCTTTCGCCTCCTGCTCGAGTTGGTTCTTGTGTAATTTGAACTTGCAACACCTACTGCCCGTCTGTCAGTAGTCGGGCATCGAA

Full Affymetrix probeset data:

Annotations for 1626917_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime