FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626918_at:

>probe:Drosophila_2:1626918_at:507:49; Interrogation_Position=105; Antisense; ATGCGCCCAATATTATTCACTTTTG
>probe:Drosophila_2:1626918_at:427:711; Interrogation_Position=120; Antisense; TTCACTTTTGCACATTCACGACATC
>probe:Drosophila_2:1626918_at:562:33; Interrogation_Position=142; Antisense; ATCAATCTGAACTACTTGCGCGACT
>probe:Drosophila_2:1626918_at:16:723; Interrogation_Position=157; Antisense; TTGCGCGACTTCTATTGTGCCAAGA
>probe:Drosophila_2:1626918_at:218:389; Interrogation_Position=196; Antisense; GAAAACCGGCAGACCACAGTGCAGC
>probe:Drosophila_2:1626918_at:531:111; Interrogation_Position=218; Antisense; AGCAACGCGTAGAGCTGCAGCGCAT
>probe:Drosophila_2:1626918_at:406:307; Interrogation_Position=24; Antisense; CCAGCACTTCGATGACCAGTTAAAG
>probe:Drosophila_2:1626918_at:311:233; Interrogation_Position=295; Antisense; AATGCTGCTGCGGAAGAGCGGCTCA
>probe:Drosophila_2:1626918_at:562:337; Interrogation_Position=315; Antisense; GCTCATCCCGGATATCGTCGTAATG
>probe:Drosophila_2:1626918_at:439:619; Interrogation_Position=335; Antisense; TAATGCAGCGAAACGCCCAACAGCT
>probe:Drosophila_2:1626918_at:290:117; Interrogation_Position=356; Antisense; AGCTTGCAACAAAACAGGCCTTACT
>probe:Drosophila_2:1626918_at:419:277; Interrogation_Position=53; Antisense; CTAGCGTCGAGTTGGGCGATTTCTC
>probe:Drosophila_2:1626918_at:478:327; Interrogation_Position=68; Antisense; GCGATTTCTCGGACGATGACCTGGC
>probe:Drosophila_2:1626918_at:175:55; Interrogation_Position=83; Antisense; ATGACCTGGCGCTCCTTGACAAATG

Paste this into a BLAST search page for me
ATGCGCCCAATATTATTCACTTTTGTTCACTTTTGCACATTCACGACATCATCAATCTGAACTACTTGCGCGACTTTGCGCGACTTCTATTGTGCCAAGAGAAAACCGGCAGACCACAGTGCAGCAGCAACGCGTAGAGCTGCAGCGCATCCAGCACTTCGATGACCAGTTAAAGAATGCTGCTGCGGAAGAGCGGCTCAGCTCATCCCGGATATCGTCGTAATGTAATGCAGCGAAACGCCCAACAGCTAGCTTGCAACAAAACAGGCCTTACTCTAGCGTCGAGTTGGGCGATTTCTCGCGATTTCTCGGACGATGACCTGGCATGACCTGGCGCTCCTTGACAAATG

Full Affymetrix probeset data:

Annotations for 1626918_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720