FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626919_at:

>probe:Drosophila_2:1626919_at:467:555; Interrogation_Position=111; Antisense; GGACGCAGAATGACCACGCCGGGCA
>probe:Drosophila_2:1626919_at:718:525; Interrogation_Position=131; Antisense; GGGCACACTTTATCGGTTGGCCAGT
>probe:Drosophila_2:1626919_at:72:65; Interrogation_Position=196; Antisense; ATGGGCAGCCGGCAAAGCCATATGC
>probe:Drosophila_2:1626919_at:51:127; Interrogation_Position=211; Antisense; AGCCATATGCGGTGGGTTCAATCCA
>probe:Drosophila_2:1626919_at:518:297; Interrogation_Position=255; Antisense; CGCATTCTGGAGTTGCTGAGAGCAC
>probe:Drosophila_2:1626919_at:274:609; Interrogation_Position=271; Antisense; TGAGAGCACCCAATAGCTTGACCTC
>probe:Drosophila_2:1626919_at:371:533; Interrogation_Position=28; Antisense; GGTGCAACTGCAGCTCGGGAAGATT
>probe:Drosophila_2:1626919_at:515:575; Interrogation_Position=304; Antisense; TGGAGCCCTCCTCTAAGGGACTACT
>probe:Drosophila_2:1626919_at:85:557; Interrogation_Position=321; Antisense; GGACTACTCAATGGACCCGGGCAGA
>probe:Drosophila_2:1626919_at:332:525; Interrogation_Position=339; Antisense; GGGCAGAACAACTGCTTTCTCAATT
>probe:Drosophila_2:1626919_at:645:695; Interrogation_Position=354; Antisense; TTTCTCAATTGTGCCGTACAGGTCA
>probe:Drosophila_2:1626919_at:385:611; Interrogation_Position=384; Antisense; TGACAACCTTCAACATCATCACTGA
>probe:Drosophila_2:1626919_at:690:337; Interrogation_Position=84; Antisense; GCTCAGTTTTTGATGTCAGCCCACA
>probe:Drosophila_2:1626919_at:399:443; Interrogation_Position=95; Antisense; GATGTCAGCCCACAGTGGACGCAGA

Paste this into a BLAST search page for me
GGACGCAGAATGACCACGCCGGGCAGGGCACACTTTATCGGTTGGCCAGTATGGGCAGCCGGCAAAGCCATATGCAGCCATATGCGGTGGGTTCAATCCACGCATTCTGGAGTTGCTGAGAGCACTGAGAGCACCCAATAGCTTGACCTCGGTGCAACTGCAGCTCGGGAAGATTTGGAGCCCTCCTCTAAGGGACTACTGGACTACTCAATGGACCCGGGCAGAGGGCAGAACAACTGCTTTCTCAATTTTTCTCAATTGTGCCGTACAGGTCATGACAACCTTCAACATCATCACTGAGCTCAGTTTTTGATGTCAGCCCACAGATGTCAGCCCACAGTGGACGCAGA

Full Affymetrix probeset data:

Annotations for 1626919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720