FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626922_at:

>probe:Drosophila_2:1626922_at:490:379; Interrogation_Position=102; Antisense; GAAGCCACTGCTGAAGACCGTAGAG
>probe:Drosophila_2:1626922_at:367:677; Interrogation_Position=122; Antisense; TAGAGGTGGAGGCACCTGCCCACTA
>probe:Drosophila_2:1626922_at:637:59; Interrogation_Position=13; Antisense; ATGTTCGCTCTCGTATCGCTTTTCA
>probe:Drosophila_2:1626922_at:597:17; Interrogation_Position=149; Antisense; ATTTCGCCTACTCGGTGCACGACGA
>probe:Drosophila_2:1626922_at:531:35; Interrogation_Position=218; Antisense; ATCAGGTCCAGGGTCAGTACACGCT
>probe:Drosophila_2:1626922_at:133:267; Interrogation_Position=232; Antisense; CAGTACACGCTGGTCGATGCCGATG
>probe:Drosophila_2:1626922_at:619:293; Interrogation_Position=252; Antisense; CGATGGCTATCTGCGCACCGTGGAC
>probe:Drosophila_2:1626922_at:304:587; Interrogation_Position=272; Antisense; TGGACTACACTTCGGATGCCCACAA
>probe:Drosophila_2:1626922_at:476:623; Interrogation_Position=288; Antisense; TGCCCACAACGGCTTCAATGCGGTG
>probe:Drosophila_2:1626922_at:716:653; Interrogation_Position=302; Antisense; TCAATGCGGTGGTGCGTCGCGATCC
>probe:Drosophila_2:1626922_at:380:701; Interrogation_Position=32; Antisense; TTTTCATCCTGGGTGTTGGTGCCGC
>probe:Drosophila_2:1626922_at:558:449; Interrogation_Position=322; Antisense; GATCCCCTGGGCCAGAAGGTGATCA
>probe:Drosophila_2:1626922_at:221:265; Interrogation_Position=334; Antisense; CAGAAGGTGATCAAGGCTGCGCCCA
>probe:Drosophila_2:1626922_at:51:333; Interrogation_Position=91; Antisense; GCGGCCATTGTGAAGCCACTGCTGA

Paste this into a BLAST search page for me
GAAGCCACTGCTGAAGACCGTAGAGTAGAGGTGGAGGCACCTGCCCACTAATGTTCGCTCTCGTATCGCTTTTCAATTTCGCCTACTCGGTGCACGACGAATCAGGTCCAGGGTCAGTACACGCTCAGTACACGCTGGTCGATGCCGATGCGATGGCTATCTGCGCACCGTGGACTGGACTACACTTCGGATGCCCACAATGCCCACAACGGCTTCAATGCGGTGTCAATGCGGTGGTGCGTCGCGATCCTTTTCATCCTGGGTGTTGGTGCCGCGATCCCCTGGGCCAGAAGGTGATCACAGAAGGTGATCAAGGCTGCGCCCAGCGGCCATTGTGAAGCCACTGCTGA

Full Affymetrix probeset data:

Annotations for 1626922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720