Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626923_at:

>probe:Drosophila_2:1626923_at:138:665; Interrogation_Position=1348; Antisense; TACATCGATCGTGAACGGGACTCAA
>probe:Drosophila_2:1626923_at:416:639; Interrogation_Position=1356; Antisense; TCGTGAACGGGACTCAATCGTGAAT
>probe:Drosophila_2:1626923_at:107:419; Interrogation_Position=1390; Antisense; GAGCTAGTCAAGGACTATCCCTCGA
>probe:Drosophila_2:1626923_at:654:147; Interrogation_Position=1403; Antisense; ACTATCCCTCGATTTGGGCCATTGG
>probe:Drosophila_2:1626923_at:612:595; Interrogation_Position=1440; Antisense; TGTGGCGTTGGTTGCCCTCACTAAA
>probe:Drosophila_2:1626923_at:575:541; Interrogation_Position=1449; Antisense; GGTTGCCCTCACTAAATGCTGTAGA
>probe:Drosophila_2:1626923_at:43:17; Interrogation_Position=1473; Antisense; ATTTGGTACCACTAAGATTCAGGAA
>probe:Drosophila_2:1626923_at:713:215; Interrogation_Position=1486; Antisense; AAGATTCAGGAATCGGCTGCTGCCG
>probe:Drosophila_2:1626923_at:566:561; Interrogation_Position=1586; Antisense; GGAAGTTGACGATACCACCAAGAAG
>probe:Drosophila_2:1626923_at:124:409; Interrogation_Position=1593; Antisense; GACGATACCACCAAGAAGAGCATAT
>probe:Drosophila_2:1626923_at:394:101; Interrogation_Position=1609; Antisense; AGAGCATATAGCTGTCCGTTACCAC
>probe:Drosophila_2:1626923_at:617:673; Interrogation_Position=1617; Antisense; TAGCTGTCCGTTACCACCCAAAAAG
>probe:Drosophila_2:1626923_at:547:135; Interrogation_Position=1655; Antisense; ACGAATGGAAGTTCAAGGCGGCGAA
>probe:Drosophila_2:1626923_at:326:405; Interrogation_Position=1698; Antisense; GACTAAGGAATCTAACACTGAGGAG

Paste this into a BLAST search page for me
TACATCGATCGTGAACGGGACTCAATCGTGAACGGGACTCAATCGTGAATGAGCTAGTCAAGGACTATCCCTCGAACTATCCCTCGATTTGGGCCATTGGTGTGGCGTTGGTTGCCCTCACTAAAGGTTGCCCTCACTAAATGCTGTAGAATTTGGTACCACTAAGATTCAGGAAAAGATTCAGGAATCGGCTGCTGCCGGGAAGTTGACGATACCACCAAGAAGGACGATACCACCAAGAAGAGCATATAGAGCATATAGCTGTCCGTTACCACTAGCTGTCCGTTACCACCCAAAAAGACGAATGGAAGTTCAAGGCGGCGAAGACTAAGGAATCTAACACTGAGGAG

Full Affymetrix probeset data:

Annotations for 1626923_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime