Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626924_a_at:

>probe:Drosophila_2:1626924_a_at:620:359; Interrogation_Position=185; Antisense; GCAACGACAAGCAGGGATTCCCCAT
>probe:Drosophila_2:1626924_a_at:684:463; Interrogation_Position=200; Antisense; GATTCCCCATGAAGCAGGGTGTCTT
>probe:Drosophila_2:1626924_a_at:582:317; Interrogation_Position=233; Antisense; GCCGTGTGCGTCTGCTCCTGAAGAA
>probe:Drosophila_2:1626924_a_at:508:613; Interrogation_Position=251; Antisense; TGAAGAAGGGACACTCCTGCTACCG
>probe:Drosophila_2:1626924_a_at:530:517; Interrogation_Position=314; Antisense; GTGGATGCATCGTGGACGCCAACAT
>probe:Drosophila_2:1626924_a_at:673:189; Interrogation_Position=334; Antisense; AACATGTCTGTGCTGGCTCTGGTCG
>probe:Drosophila_2:1626924_a_at:363:593; Interrogation_Position=419; Antisense; TGGGACCCAAGCGTGCTAGCAAGAT
>probe:Drosophila_2:1626924_a_at:127:677; Interrogation_Position=435; Antisense; TAGCAAGATCCGCAAGCTCTACAAC
>probe:Drosophila_2:1626924_a_at:342:215; Interrogation_Position=470; Antisense; AAGATGATGTGCGTCGCTTCGTTGT
>probe:Drosophila_2:1626924_a_at:393:113; Interrogation_Position=587; Antisense; AGCACCGTCGCATTGCGCTGAAGAA
>probe:Drosophila_2:1626924_a_at:501:97; Interrogation_Position=620; Antisense; AGATCGCTTCCAAGGAGGCTTCCGC
>probe:Drosophila_2:1626924_a_at:407:673; Interrogation_Position=649; Antisense; TACGCCAAGCTGTTGGTGCAGCGCA
>probe:Drosophila_2:1626924_a_at:297:9; Interrogation_Position=727; Antisense; ATTCGCGAGTCCAAGAGCTCTGTCT
>probe:Drosophila_2:1626924_a_at:330:419; Interrogation_Position=741; Antisense; GAGCTCTGTCTCCAGCGACAAGAAG

Paste this into a BLAST search page for me
GCAACGACAAGCAGGGATTCCCCATGATTCCCCATGAAGCAGGGTGTCTTGCCGTGTGCGTCTGCTCCTGAAGAATGAAGAAGGGACACTCCTGCTACCGGTGGATGCATCGTGGACGCCAACATAACATGTCTGTGCTGGCTCTGGTCGTGGGACCCAAGCGTGCTAGCAAGATTAGCAAGATCCGCAAGCTCTACAACAAGATGATGTGCGTCGCTTCGTTGTAGCACCGTCGCATTGCGCTGAAGAAAGATCGCTTCCAAGGAGGCTTCCGCTACGCCAAGCTGTTGGTGCAGCGCAATTCGCGAGTCCAAGAGCTCTGTCTGAGCTCTGTCTCCAGCGACAAGAAG

Full Affymetrix probeset data:

Annotations for 1626924_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime